Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Screening kit for metastatic screening of papillary thyroid micro carcinoma

A technology for papillary carcinoma and thyroid gland, applied in the direction of microbial determination/inspection, instruments, measurement devices, etc., can solve the problem of lack of transcriptomics, and achieve the effect of avoiding excessive treatment, reducing psychological burden, and reducing economic burden.

Active Publication Date: 2018-11-06
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are no transcriptomic studies and literature reports related to papillary thyroid carcinoma (PTC) and papillary thyroid microcarcinoma (PTMC) (tumor diameter ≤ 1cm)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening kit for metastatic screening of papillary thyroid micro carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 The relationship between the expression level of Trpc5 and the status of papillary thyroid microcarcinoma

[0021] 1. Pathological collection

[0022] The PTMC cases who underwent the first operation from December 2016 to May 2018 in West China Hospital of Sichuan University were collected. Before the operation, all signed the informed consent for specimen retention. Those who met the above conditions were routinely collected the pathological tissue specimens of surgical resection, and intraoperative thyroidectomy. Within 15 minutes of excision of the gland lobe where the cancer foci are located, the cancer foci and normal tissues were taken in separate tubes and filled with liquid nitrogen, and the patient information was registered in detail to make a record. A few months later, a pathological examination was performed to determine whether the lymph node had high metastasis or no metastasis, and were strictly selected for inclusion. The expression levels of ...

Embodiment 2

[0046] Embodiment 2 Composition of the kit for detecting Trpc5 of the present invention and its use method

[0047] 1. PCR detection kit

[0048] 1. Composition of the kit

[0049] Test kit (50 people):

[0050] component

volume

upstream primer

0.5ul(10μM)

downstream primer

0.5ul(10μM)

2×PCR Enzyme Mix

10μL

dd water

to a total volume of 20 μL

[0051] The Trpc5 primer sequences are as follows:

[0052] Forward: TCCTGTTTCCCATGCTGTCT

[0053] Reverse: GCCCCTGTACATGAAGGTCT.

[0054] 2. How to use the kit

[0055] The tissue stored in liquid nitrogen was taken out, placed on ice for 5 minutes to soften, crushed with a tissue homogenizer, weighed, and 1 ml of TRIZOL was added per 100 mg of tissue. Add 0.2 ml of chloroform to each sample lysed with 1 ml of TRIZOL reagent, and cap the tube tightly. After vigorously shaking the tube by hand for 15 seconds, incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 120...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a screening kit for metastatic screening of papillary thyroid micro carcinoma and use thereof. The screening kit effectively determines whether or not a detection object suffers from metastatic papillary thyroid micro carcinoma, the patient of which the test result is positive is suggested with early surgery, and the patient of which the test result is negative can continueto be observed, so that excessive treatment and insufficient treatment of the papillary thyroid micro carcinoma are avoided, and the clinical application prospect is excellent.

Description

technical field [0001] The present invention relates to a detection method for thyroid microscopic papillary carcinoma. Background technique [0002] The incidence of thyroid cancer is increasing rapidly worldwide, and it is the fastest growing solid malignant tumor. It is expected that by 2019, thyroid cancer will become the third most common malignant tumor in women. Most of these new cases were papillary thyroid microcarcinoma (PTMC), a papillary thyroid carcinoma with a tumor diameter of ≤1 cm. The proportion of PTMC in new thyroid cancers varies from 40% to 50%, depending on the country. At present, whether there is overdiagnosis and treatment of papillary thyroid microcarcinoma patients at home and abroad is one of the most popular and controversial topics in thyroid surgery. However, at present, there is no method at home and abroad to accurately judge the invasiveness and prognosis of PTMC before surgery. It is impossible to predict in advance which PTMC will cause...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886G01N33/574
CPCC12Q1/6886C12Q2600/118C12Q2600/158G01N33/57407G01N33/57484
Inventor 龚艳萍朱精强李志辉
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com