Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

63results about How to "Realize individualized treatment" patented technology

Multiplex-PCR (polymerase chain reaction) detection method and kit for BRCA1 and BRCA2 gene mutation

ActiveCN105200154ALow costLow demandMicrobiological testing/measurementBRCA2 MutationGenetics
The invention provides a method and a kit for detecting BRCA1 and BRCA2 gene mutation. The method and the kit utilize two sets of PCR (polymerase chain reaction) primers, wherein a first set of PCR primers comprises 189 pairs of PCR primers and is divided into two groups, a first group comprises 95 pairs of primers with sequences represented as SEQ ID NO.5-SEQ ID NO.194, a second group comprises 94 pairs of primers with sequences represented as SEQ ID NO.195-SEQ ID NO.382, a sequence represented as SEQ ID NO.1 is added to the 5' end of each upstream primer, and a sequence represented as SEQ ID NO.2 is added to the 5' end of each downstream primer; sequences of upstream and downstream primers of a second set of PCR primers are represented as SEQ ID NO.3 and SEQ ID NO.4.
Owner:艾吉泰康(嘉兴)生物科技有限公司

Tumor-targeted delivery carrier based on cell-derived micro-vacuoles, preparation method and application

The invention discloses a tumor-targeted delivery carrier based on cell-derived micro-vacuoles, a preparation method and an application. The preparation method comprises the following steps of: (A) preparing a conditioned medium: supplementing fetal bovine serum, antibiotics, DSPE-PEG-Biotin and DSPE-PEG-Folate into a basal medium; (B) using the obtained conditioned medium in cell culture, and collecting cell culture supernatant for subsequent separation; (C) carrying out low-speed centrifugation on the obtained culture supernatant to remove cell debris and apoptotic bodies, then adding SA-IONPs, mixing uniformly, incubating, then separating by a magnet, using PBS for re-suspension, eluting for multiple times to obtain the cell-derived micro-vacuoles with membrane surfaces modified by folic acid and iron oxide nano-particles, and freezing for storage; and (D) loading chemotherapeutic drugs or therapeutic genes into the functionalized micro-vacuoles doubly-modified by an electroporation mode, and carrying out re-suspension after separation with the magnet. The tumor-targeted delivery carrier based on cell-derived micro-vacuoles, the preparation method and the application disclosed by the invention are applicable to specific targeting delivery of multiple chemotherapeutic drugs and therapeutic genes, and have the advantages of enhancing the anti-tumor effect, reducing the systemic toxicity and improving the clinical effect of the current therapeutic selection, so that a new hope is brought for clinical therapy of tumors.
Owner:珈泌生物科技(武汉)有限责任公司

System for predicting number of oocytes obtained during ovarian stimulation of object

The invention relates to a system for predicting the number of oocytes obtained during ovarian stimulation of an object receiving a standard GnRH antagonist solution for ovulation induction. The system comprises a data acquisition module used for obtaining data of the anti-mullerian hormone (AMH) level, basal follicle stimulating hormone (FSH) level and antrum follicle count (AFC) of the object and a module used for predicting the number of the oocytes obtained during the ovarian stimulation and calculating the information obtained in the data acquisition module to calculate the number of theoocytes (NROs) obtained by the object.
Owner:湖南康晴生物科技有限公司

Marker for locally advanced esophageal squamous cell carcinoma prognosis and application of marker

The invention relates to the field of bioengineering and tumor markers, in particular to a marker for locally advanced esophageal squamous cell carcinoma prognosis and an application of the marker. The marker is a combined marker consisting of one or more of miR-135b-5p, miR-139-5p, miR-29c-5p and miR-338-3p, and locally advanced esophageal squamous cell carcinoma prognosis is predicted by detecting expression levels of the four miRNA in tumor tissue and performing calculation according to a formula (0.4690*miR-135b-5p expression level)+(0.3839*miR-139-5p expression level)+(0.1733*miR-29c-5p expression level)+(0.3368*miR-338-3p expression level). The combined marker has the advantages of good stability and high sensitivity and specificity and can more accurately and more valuably evaluateprognosis of patients than traditional clinical pathological factors such as TNM (tumor-node-metastasis) staging and the like. On one hand, the molecular marker related to esophageal squamous cell carcinoma prognosis is provided, on the other hand, an esophageal squamous cell carcinoma prognosis prediction model is established, so that individual treatment of esophageal squamous cell carcinoma isrealized, the comprehensive treatment level of the esophageal squamous cell carcinoma is improved, the life quality of esophageal squamous cell carcinoma patients is improved, and the lifetime of theesophageal squamous cell carcinoma patients is prolonged.
Owner:SUN YAT SEN UNIV CANCER CENT

Human tissue-engineered cardiac muscle tissue

The invention belongs to the field of biomedical engineering, and relates to a human tissue-engineered cardiac muscle tissue and a preparation method thereof. The human tissue-engineered cardiac muscle tissue disclosed by the invention is prepared by inoculating all kinds of cell components of a normal heart differentiated from human induced multipotential stem cells by taking a natural decellularized heart substrate as the scaffold. The human tissue-engineered cardiac muscle tissue has cell components, extracellular matrixes and biological functions similar to that of a normal human cardiac muscle tissue; testing and screening of in-vitro drugs, initial in-vivo transplantation researches of clinical earlier-stage small animals and observation of treatment effects can be carried out; and helps can be finally offered for realizing individualized treatment of human cardiovascular diseases.
Owner:FUDAN UNIV

Method for screening potential biomarkers of gastric cancer based on weighted gene co-expression network analysis, and application thereof

The invention relates to the biomedicine field, and specifically relates to a method for screening potential biomarkers of gastric cancer based on weighted gene co-expression network analysis, and application thereof. The method for screening potential biomarkers of gastric cancer adopts weighted gene co-expression network analysis (WGCNA) and KEGG pathway and GO enrichment analysis, and other analysis methods. Weighted Gene Co-Expression Network Analysis (WGCNA) is an efficient and comprehensive method for high-dimensional data analysis, and the accuracy and validity in analyzing gene chip data of the WGCNA has been confirmed. The potential biomarker screened by the method of the invention is FERMT2. The method for screening potential biomarkers of gastric cancer based on weighted gene co-expression network analysis provides a new direction for the diagnosis, treatment and prognosis of gastric cancer, and promotes the development of individualized treatment.
Owner:辽宁省肿瘤医院

SNP marker related to liver toxicity of platinum type chemotherapeutic medicines and applications thereof

The invention belongs to the fields of genetic engineering and oncology, and discloses an SNP marker related to liver toxicity of platinum type chemotherapeutic medicines and applications thereof. The marker is a composition of rs6681909, rs4140932, rs13131227, rs4446279, rs17053350, rs9402873, rs16878272, rs13267737, rs7008590, rs947853, rs2838566, rs1383888, rs9642723, rs3822296, rs2160046, rs10002931, rs10032941, rs6449138, rs1048037 and rs10086636. The marker and primer probes thereof can be used for preparing a diagnosis kit of the liver toxicity of platinum type chemotherapeutic medicines, and are good in sensitivity and specificity.
Owner:NANJING YIKE POPULATION HEALTH RES INST CO LTD

Esophageal squamous carcinoma radical postoperative patient prognosis prediction model construction method and device

The invention discloses an esophageal squamous carcinoma radical postoperative patient prognosis prediction model construction method and device, and the method comprises the steps: obtaining clinical diagnosis and treatment data and follow-up visit survival data, carrying out multi-factor Cox regression analysis on patient characteristic variables, tumor pathology characteristic variables, treatment condition variables and test index variables according to follow-up visit survival data, carrying out variable screening by utilizing a step-by-step back algorithm and an Akaike information criterion, and carrying out variable screening on the screened candidate variables again to obtain modeling variables; and performing multi-factor Cox regression analysis on modeling variables and interaction items of every two modeling variables to construct a prognosis prediction model of a patient after the esophageal squamous carcinoma radical operation, wherein the prediction variables comprise age, gender, tumor primary position, T stage, lymph node detection number, tumor size, preoperative hemoglobin level and N stage treatment mode interaction items. According to the method, the prediction accuracy can be improved, the optimal benefit group of different treatment schemes is defined, and the prognosis evaluation precision of the esophageal squamous cell carcinoma is realized.
Owner:BEIJING CANCER HOSPITAL PEKING UNIV CANCER HOSPITAL

Application of lncRNA combination to preparation of product for predicting renal clear cell carcinoma prognosis and molecular targeted medicine treatment sensitivity

InactiveCN108277283ASensitivity PreciseSensitivity Rapid JudgmentMicrobiological testing/measurementMolecular targeted drugRenal clear cell carcinoma
The invention discloses application of lncRNA combination to preparation of a product for predicting renal clear cell carcinoma prognosis and molecular targeted medicine treatment sensitivity. The lncRNA or the lncRNA combination serving as a detection target point is applied to preparation of the product for predicting renal clear cell carcinoma prognosis and molecular targeted medicine treatmentsensitivity, and the lncRNA or the lncRNA combination is selected from any one or more of SEQ ID NO.1 to SEQ ID NO.4. A new clinical method is provided for evaluating prognosis of patients sufferingfrom renal clear cell carcinoma, new reference advice is provided for auxiliary treatment after operation of the renal clear cell carcinoma, and important clinical significance and popularization andapplication prospect in the aspects of timely taking effective clinical measures, formulating an individualized diagnosis and treatment scheme and finally increasing the survival rate of the patientssuffering from the renal clear cell carcinoma are achieved.
Owner:NANJING GENERAL HOSPITAL NANJING MILLITARY COMMAND P L A

Hand-foot rehabilitation therapeutic instrument

The invention relates to the technical field of a machine, in particular to a hand-foot rehabilitation therapeutic instrument, which comprises a wrist sleeve and a palm sleeve disposed at one end of the wrist sleeve, wherein the other end of the palm sleeve is provided with a plurality of finger sleeves. The hand-foot rehabilitation therapeutic instrument is in contact with the finger joint of thefingers through an eccentric wheel of a micromotor to perform activities on the knuckles of a patient, promotes the recovery of the extremity of the limb, reduces disability, and reduces the burden on the family and society. A fingertip massage method is the same as the reverse playing of a piano, a finger rest corresponding to a note is ejected to facilitate the massage of the patient's finger,an AH173 Hall sensor can count the number of grip strengths so as to facilitate feedback on the treatment situation in time, and by setting a wireless control device, the operation of the product canbe continuously carried out to complete the rehabilitation treatment in the event that the patient has speech ambiguity.
Owner:昆山市第一人民医院

Heart and brain dual targeting lipidosome as well as preparation method and applications of heart and brain dual targeting lipidosome

ActiveCN108653743AIndividualized treatmentRealize the unity of heart and brainNervous disorderInorganic active ingredientsMannosePediatrics
The invention discloses a heart and brain dual targeting lipidosome as well as a preparation method and applications of the heart and brain dual targeting lipidosome. The heart and brain dual targeting lipidosome is obtained by coupling an Anti-cTnI protein antibody or a fragment of the Anti-cTnI protein antibody on the surface of a lipidosome modified by an acetylated glycoester-polyethylene glycol-phosphatidyl ethanolamine conjugate as shown in the formula I. According to the technical scheme, by modifying the mannose molecule derivative and the Anti-cTnI protein antibody on the surface of the lipidosome, the lipidosome has the dual targeting effects including brain targeting and heart targeting, and the treatment for the heart and the brain can be realized. The in-vitro cell experiment,the affinity experiment and the in-vivo distribution experiment prove that the lipidosome can treat myocardial diseases, and also can span the blood brain barrier for treating diseases caused by cardiogenic diseases. In addition, by changing the length of the PEG (Linker) on the surface of the lipidosome, the spatial positions of the sugar molecule derivative and the antibody can be changed, thusthe distribution of medicines in the heart and the brain tissue can be changed, the distribution change of the medicines in the heart and the brain can be regulated, and the individualized treatmentis realized.
Owner:HARBIN MEDICAL UNIVERSITY

Refined and scientific diagnosis and treatment system

The invention relates to a refined and scientific diagnosis and treatment system. The system comprises patient terminals, department terminals in hospitals and a central processor, wherein the central processor serves as a transfer connecting the patient terminals with the department terminals, and is also connected to the national identity information system; the patient terminals are provided with photographing and scanning structures and fingerprint recognition structures; all information about the departments in the hospitals and disease diagnosis and treatment conditions is stored in the central processor; the patient terminals are also provided with orientation systems while the central processor is provided with a position analysis system; the patient terminals are internally provided with payment modules while the central processor is internally provided with a fund reception module; in addition, the central processor is also connected to the medical insurance system, and the patient terminals are internally provided with medical insurance card-bonding structures, so a person can directly see a doctor and pay with a medical insurance card. Through the refined and scientific diagnosis and treatment system, the hospitals and the departments of the hospitals can be connected, thereby enabling patients to see a doctor in a nearby hospital and pay online.
Owner:PEKING UNION MEDICAL COLLEGE HOSPITAL CHINESE ACAD OF MEDICAL SCI

Kit for predicting treatment effects of GC (glucocorticoid) on SLE (systemic lupus erythematosus) based on HSP90AA1 genotypes

The invention relates to a kit for predicting the treatment effects of GC (glucocorticoid) on SLE (systemic lupus erythematosus) based on HSP90AA1 genotypes. The kit comprises the following components: primers for detecting the HSP90AA1 gene polymorphism site genotypes, PCR (polymerase chain reaction) amplification enzymes and corresponding buffer solutions, PCR product purification enzymes, dNTP, single base extension reaction enzymes and corresponding buffer solutions and single base extension product purification enzymes. The invention provides the kit and a method, which are used for predicting the treatment effects of GC on SLE based on the HSP90AA1 gene polymorphism site genotypes. The rs7160651, rs10873531 and rs2298877 polymorphism site genotypes can be used for predicting the treatment effects of GC on SLE and provide a new idea and method for guiding individualized treatment of SLE patients.
Owner:ANHUI MEDICAL UNIV

SNP marker composition related to brain radiation injury caused by radiotherapy and application thereof

The invention discloses an SNP marker composition related to onset risk of brain radiation injury caused by tumor radiotherapy and application thereof. The SNP marker composition comprises 15 SNP loci. Meanwhile, a kit for predicating the onset risk of brain radiation injury caused by tumor radiotherapy is prepared, the kit is adopted to detect types of SNP markers, and the onset risk of onset risk of patients suffering from nasopharyngeal carcinoma can be more comprehensively and accurately detected estimated through clinic information of the patients. Through the adoption of the SNP marker composition to clinical applications, and adoption of protective measures in advance to high-risk patients, the SNP marker composition is beneficial to implementation of individualized treatment to thepatients, and improves the long-term survival quality of the patients suffering from nasopharyngeal carcinoma. Meanwhile, the SNP marker composition can provide a method and tactical reference for the predication of risk of normal tissue injury caused by other radiotherapies.
Owner:SUN YAT SEN UNIV

Low frequency therapeutical device for promoting nerve recovery and musclar movement

A low-frequency therapeutic apparatus for promoting the restoration of nerve and the movement of muscle is composed of a host consisting of oscillator, rectifier, filter, mode selection key, microprocessor with registers, and full-bridge PWM pulse amplifier, the output electrodes, and the connection lines between said host and output electrodes.
Owner:上海塔瑞莎健康科技有限公司

SNP markers related to hand-foot syndrome and application thereof

The invention discloses SNP markers related to hand-foot syndrome and application thereof, and specific amplification primers and specific probes for detecting the marker. The SNP markers are rs2853741 and rs1890775, the nucleotide sequences of the specific amplification primers are respectively shown as SEQ ID NO.1-4, and the nucleotide sequences of the specific probes are respectively shown as SEQ ID NO.5-8. The SNP markers provided by the invention have high specificity and sensitivity, and can well predict the susceptibility for treating the hand-foot syndrome of a patient to by using a tumor chemotherapeutic drug capecitabine. The SNP markers, the amplification primers and a related kit can be used for evaluating the risk and the severity of hand-foot syndrome of the patient, can adopt protective measures in advance aiming at high-risk patients, is beneficial to realizing individualized treatment for the patient, is beneficial to the treatment of the patient and improves the lifequality of the patient.
Owner:SUN YAT SEN UNIV +1

Lnc RNA model for prediction of postoperative survival of pancreatic cancer and detection kit

The invention belongs to the field of biomedicines and relates to an Lnc RNA model for prediction of poor prognosis risk of pancreatic cancer patients and a detection kit. The model includes four parts: sample collection, RNA extraction, Lnc RNA measurement, and Lnc RNA expression quantity weighting calculation. The Lnc RNA includes seventeen Lnc RNAs which are obtained through screening and are related to prognosis of the pancreatic cancer. In the invention, by detecting the expression level of the Lnc RNA of patients, the model can be applied to clinical determination on prognosis of the pancreatic cancer patients; the seventeen Lnc RNAs can be used as markers for predicting postoperative survival of pancreatic cancer patients. The invention also provides the corresponding kit, by whichthe level of the Lnc RNA of the postoperative pancreatic cancer patients can be detected in order to determine the prognosis of the pancreatic cancer patients. The model and the kit are high in throughput and sensitivity.
Owner:AFFILIATED HUSN HOSPITAL OF FUDAN UNIV

Gene detection kit for detecting individual drug use of tacrolimus drug

The invention provides a gene detection kit for detecting individualized drug use of a tacrolimus drug. The kit comprises the following components including two pairs of PCR amplification and sequencing primers for CYP3A5*3 (-253-1A>G) and POR (1508C>T) site regions, a PCR amplification reagent, a PCR product purification reagent and a DNA sequencing reagent. According to the sequencing primers for the CYP3A5*3 (-253-1A>G) site, the forward primer is TGCCCTTGCAGCATTTAG, and the reverse primer is ACACCCAGGAAGCCAGAC; according to the sequencing primers for the POR (1508C>T) site, the forward primer is GGTGGTTGTGGAGTACGAGA, and the reverse primer is CGCTCCTGGATGAAGCCTAT. The kit is used for genotyping detection of the CYP3A5*3 (-253-1A>G) and POR (1508C>T). By applying the kit in detection, the individual drug metabolism type including a normal metabolite and a slow metabolism type can be identified, the drug dosage is adjusted, the drug efficacy is improved, the toxic and side effects ofthe drug are reduced, and individualized treatment is realized.
Owner:上海佰臻生物科技有限公司

Kit for predicting curative effect of glucocorticoids on curing SLE (Systemic Lupus Erythematosus) on basis of HSP90AB1 genotype

The invention relates to a kit for predicting the curative effect of glucocorticoids on curing SLE (Systemic Lupus Erythematosus) on basis of an HSP90AB1 genotype. The kit comprises the components: a primer for detecting the HSP90AB1 gene polymorphism site genotype, a PCR (Polymerase Chain Reaction) amplification enzyme and a corresponding buffer solution, a PCR product purification enzyme, dNTP (Diethyl-nitrophenyl Thiophosphate), a single-base extension reaction enzyme and a corresponding buffer solution, and a single-base extension product purification enzyme. When the HSP90AB1 gene rs9367190 polymorphism site genotype is CA and / or AA, the curative effect of the glucocorticoids on curing the SLE (Systemic Lupus Erythematosus) is predicted to be good. When a haplotype formed by rs9367190 and rs13296 polymorphism sites is CA, the curative effect of the glucocorticoids on curing the SLE is predicted to be poor. When an rs13296 polymorphism site genotype is GA and / or AA, the living quality (the mental health) improvement of an SLE patient cured by the glucocorticoids is predicted to be poor. The invention provides a new idea and a new method for guiding individualized treatment of SLE patients.
Owner:ANHUI MEDICAL UNIV

Intelligent angle-measurement multifunctional auxiliary treatment chair for cervical spondylosis

The invention relates to the technical field of medical devices, in particular to an intelligent angle-measurement multifunctional auxiliary treatment chair for cervical spondylosis, and aims to solve problems that with acceleration of pace of life, long-term overtime working, driving and the like of young people are increasingly common and patients with cervical spondylosis are continuously increased. Front flexion and rear extension, left and right rotation, and left and right lateral flexion and traction are independently controlled by stepping motors for independent movement and sequential and circular movement, and program control is facilitated; Height of a chair seat and a head fixing device can be freely adjusted, and individualized treatment can be achieved for patients with different illness conditions; the patients can freely change body positions between 90 degrees (sitting posture) and 180 degrees (lying posture), movement angles and traction forces have program and mechanical dual protection functions, and neck movement angles and the traction forces are strictly controlled within an allowable range; and a wireless device is used to meet operation requirements of the patients at different treatment body positions, such that the intelligent angle-measurement multifunctional auxiliary treatment chair can realize self-service treatment, and is suitable for hospital treatment and family treatment.
Owner:UNIV FOR SCI & TECH ZHENGZHOU

Application of cisplatin combined with hTERT-HRP/IAA in medicament for treating cervical cancer cell

The invention discloses an application of cisplatin combined with phTERTp-HRP / IAA in drugs for the treatment of cervical cancer cells, in particular to the strengthening role of the cisplatin on the activity of a hTERT gene promoter. The cisplatin and the phTERTp-HRP / IAA are commonly used in the synergy for killing the human cervical cancer cells, and the action mechanism thereof is further explored. The application adopts Hela cells for carrying out the study and evaluates the impacts of the cisplatin on the activity of the hTERT promoter through the expression of downstream luciferase reporter gene regulated by the hTERT promoter. The synergic killing role and the mechanism of the cisplatin and the hTERT promoter during the combined use for regulating the gene therapy of an HRP / IAA system are evaluated through the detection of cell proliferation rate, cell apoptosis rate and cell cycle. The results confirm that the cisplatin can strengthen the activity of the hTERT gene promoter; and when in combined use with the phTERTp-HRP / IAA, the killing role of the human cervical cancer cells is significant.
Owner:WUHAN UNIV

3D printed vaginal drug delivery device

The invention discloses a 3D printed vaginal drug delivery device. The device is prepared through 3D printing, and polymer, medicine, pore former and surface active agent are included. The shape of the device can be selected from an O-shape, a Y-shape, an M shape, a T shape, a V shape, a U shape, a twisted shape, a triangle shape, an anchor shape, and other special shapes designed according to disease demands and personal characteristics. The device is characterized in that an individualized design is adopted, medicine carrying dosage can be adjusted, using is convenient, and the shape and themedicine carrying dosage can be flexibly changed according to the personal characteristics and demands to achieve personalized treatment.
Owner:ACADEMY OF MILITARY MEDICAL SCI

Medicine development and preparation using absorbed and metabolized natural medicine component as main component

The present invention relates to Chinese medicine developing method and its application in preparing medicine, and is especially the medicine developing method with human body or aninal body absorbed and metabolized medicine components as medicine, the application of the method and developed medicine. The medicine developing process includes the following five steps: 1. metabolizing Chinese medicine in biological filtering system to obtain metabolized monomers; 2. separating and identifying the metabolized monomers and separated pharmacological analysis; 3. determining effective monomer components; 4. extracorporeal synthesis or extraction of the effect monomers; and 5. mixing the effective metabolized monomers to obtain new type selective metabolized single-monomer medicine.
Owner:大连弘毅生物技术有限公司

An SNP marker located in a DISC1FP1 gene and related to radiation induced brain injuries caused by radiotherapy and applications thereof

The present invention discloses an application, of an SNP site rs10501719 on a DISC1FP1 gene, as a marker associated with the risk of radiation induced brain injuries caused by tumor radiotherapy. A kit for predicting the risk of radiation induced brain injuries caused by tumor radiotherapy is prepared. The kit can be used to detect SNP marker typing, and clinical information of patients can be combined to more comprehensively and accurately assess the risk of occurrence of radiation induced brain injuries in patients with nasopharyngeal carcinoma. The kit is applied to clinical practice, andprotective measures are taken in advance for high-risk patients, thus facilitating individualized treatment of patients and improving long-term quality of life of patients with nasopharyngeal carcinoma. In addition, a methodological and strategic reference for risk prediction of normal tissue injuries caused by other radiotherapy can be provided.
Owner:SUN YAT SEN UNIV

Tissue engineering bone tissue and preparation method thereof

The invention discloses tissue engineering bone tissue and a preparation method thereof. The tissue engineering bone tissue is characterized in that the tissue engineering bone tissue is composed of a bone cortex frame constructed by reshaped cortical bone support materials and sponge bones filled in hollow positions of the bone cortex frame, and the reshaped cortical bone support materials are molded according to specific coloboma shapes of bones which need repairing. The tissue engineering bone tissue has a cortical bone, a sponge bone and cellular constituents similar to those of normal bone tissue. In clinical application, a physician can pre-determine the resection range according to a computed tomography (CT) slice of a patient, and reshapes the tissue engineering bone support materials according to CT reconstruction data of the coloboma part so as to achieve individual treatment.
Owner:XIAN REJE BIOLOGICAL TECH

Biomarker for predicting tumor drug sensitivity and related product thereof

The invention discloses a biomarker for predicting tumor drug sensitivity and a related product thereof, wherein the biomarker is HLA-F, CLHC1 and / or ELFN1, and the product comprises a reagent for detecting the expression level of the biomarker. The biomarker and the related product thereof are used for predicting the sensitivity of metastatic melanoma patients to an immunotherapy drug MAGE-A3, clinical medication is guided by using the biomarker and the related product thereof provided by the technical scheme of the invention, not only can the blindness of drug selection be avoided, but also the treatment effect of the drug can be monitored in the treatment process, and the purposes of medication reasonability and individualized treatment are achieved.
Owner:QINGDAO MEDINTELL BIOMEDICAL CO LTD

Application of ARRDC2 in evaluating development process of oral squamous cell carcinoma

The invention discloses an application of ARRDC2 in evaluating the development process of oral squamous cell carcinoma. According to the invention, by means of high throughput sequencing and bioinformatics analysis, gene ARRDC2, which indicates significant changes in different development processes of the tumor, is screened, and ARRDC2 is suggested, as a marker molecule, to be applied to determination of the development of the oral squamous cell carcinoma, prediction of the prognosis of the tumor and guiding of therapeutic plans and curative effect monitoring.
Owner:XIANGYA STOMATOLOGICAL HOSPITAL CENT SOUTH UNIV

Target gene for diagnosis of oral squamous cell carcinoma and application thereof

The invention discloses a target gene for diagnosis of oral squamous cell carcinoma and application thereof. By screening genes with an expression level related to a tumor differentiation level, the expression of genes in tumor tissues in each differentiation level is determined, so that the differentiation level of a tumor is determined, thereby accurately and objectively predicting the tumor prognosis, guiding the formulation of a treatment plan and monitoring a therapeutic effect.
Owner:THE SECOND HOSPITAL OF HEBEI MEDICAL UNIV

Tumour universal type fibroblast vaccine as well as preparation method and applications thereof

The invention belongs to the field of biological medicine, and relates to basic fibroblast growth factor activated fibroblast as well as a preparation method and an application thereof. The invention aims at solving the technical problem for providing a new selection for tumour treatment. The invention provides a tumour universal type fibroblast vaccine, and a main active component of the vaccine is inactivated basic fibroblast growth factor activated fibroblast. The invention aims at providing the novel cell vaccine for researching and developing tumour fibroblast; and the vaccine can inhibit a plurality of tumours, and is used as a universal antineoplastic vaccine for control of colorectal carcinoma, lung cancer, fibrosarcoma and the like.
Owner:WEST VAC BIOPHARMA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More