Unlock instant, AI-driven research and patent intelligence for your innovation.
Gene detection kit for detecting individual drug use of tacrolimus drug
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A gene detection and tacrolimus technology, which is applied in the field of gene detection kits for the detection of individualized drug use of tacrolimus drugs, to achieve the effects of reducing drug side effects, realizing individualized treatment, and improving drug efficacy
Inactive Publication Date: 2019-10-22
上海佰臻生物科技有限公司
View PDF0 Cites 3 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0004] The existing technology mainly has the following technical problems: lack of a tacrolimus individualized drug gene detection kit for the Chinese population with high detection sensitivity and high accuracy
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0025] A gene detection kit for detecting individualized drug use of tacrolimus, comprising the following components:
[0026] (1) CYP3A5*3 (-253-1A>G) and POR (1508C>T) site amplification and sequencing primers 2 pairs, each primer 1OD, primer sequence see Table 1;
[0035] (2) PCR amplification of CYP3A5*3 (-253-1A>G) and POR (1508C>T) loci
[0036] For CYP3A5*3 (-253-1A>G) and POR (1508C>T) sites, design primers according to Table 1 for PCR amplification. Each reaction system has a total volume of 16 μL, including 7.5 μL of Taq enzyme mixture (dNTP, 10×PCR reaction buffer, MgCl2), 5.5 μL of deionized water, primer pair (10uM) 1 μL, genomic DNA (100ng / ul) 1ul ;The reaction condition is 95°C for 15min, 14 cycles (-0.5°C / cycle) of 94°C for 30sec, 63°C for 30sec, 72°C for 45sec; then 30 cycles of 94°C for 30sec, 56°C for 30sec, 72°C for 45sec, Finally, 72°C for 10min;
[0037] (3) Purification of PCR products
[0038] Each reaction has a total volume of 5.6 μL. 4 μL of PCR product was added, and then 1.6 μL of SAP enzyme mixture (SAP enzyme, ExoI enzym...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a gene detection kit for detecting individualized drug use of a tacrolimusdrug. The kit comprises the following components including two pairs of PCR amplification and sequencing primers for CYP3A5*3 (-253-1A>G) and POR (1508C>T) site regions, a PCR amplification reagent, a PCR product purification reagent and a DNA sequencing reagent. According to the sequencing primers for the CYP3A5*3 (-253-1A>G) site, the forward primer is TGCCCTTGCAGCATTTAG, and the reverse primer is ACACCCAGGAAGCCAGAC; according to the sequencing primers for the POR (1508C>T) site, the forward primer is GGTGGTTGTGGAGTACGAGA, and the reverse primer is CGCTCCTGGATGAAGCCTAT. The kit is used for genotyping detection of the CYP3A5*3 (-253-1A>G) and POR (1508C>T). By applying the kit in detection, the individual drugmetabolism type including a normal metabolite and a slow metabolism type can be identified, the drug dosage is adjusted, the drug efficacy is improved, the toxic and side effects ofthe drug are reduced, and individualized treatment is realized.
Description
technical field [0001] The invention relates to the field of biotechnology, in particular to a gene detection kit for detecting individualized drug use of tacrolimus. Background technique [0002] The calcineurin inhibitor tacrolimus is a macrolide antibiotic isolated from the metabolites of Streptomyces and was used clinically in 1989. It mainly inhibits the activation process of T cells by specifically inhibiting the activity of neural calcineurin. At the same time, it also produces T cell-dependent antibodies that cyclosporine does not have, and blocks the transcription of cytokines, presenting a double effect. Immunosuppressive effect. Tacrolimus is mainly used for graft rejection after liver or kidneytransplantation. However, due to the narrow therapeutic window of tacrolimus and the large individual differences in pharmacokinetics, it is administered according to the conventional dose, and some patients may suffer from "insufficient immunosuppression" due to too low...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More