17 results about "Clear cell" patented technology

The invention discloses an application of a therapeutic target spot in preparation of a drug for treating targeted therapy resistance of kidney cancer. The therapeutic target spot is SLC27A3. The SLC27A3 comprises an SLC27A3 gene and a coding sequence thereof, an expression product of the SLC27A3 gene and a coding sequence thereof, and the SLC27A3 gene and an active fragment or derivative of the expression product thereof; the nucleotide of the SLC27A3 is as shown in SEQ ID NO. 1. According to the invention, a therapeutic target SLC27A3 is knocked out or silenced, and a compound Parishin for resisting the SLC27A3 protein is provided, so that the resistance of renal clear cell carcinoma cells to the pezopanib is remarkably improved, and the sensitivity of renal carcinoma cells to the pezopanib is enhanced.

The invention discloses an application of non-therapeutic GLYR1 protein in regulating and controlling proliferation and / or migration of renal clear cell carcinoma cells, which is characterized in that the expression of GLYR1 is knocked down so as to promote the proliferation and / or migration of the renal clear cell carcinoma cells, a reagent adopted for knocking down the expression of the GLYR1 is si-GLYR1 # 1, a positive-sense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGUCGAAGA, an antisense strand of the si-GLYR1 # 1 is UCUUCGACAGCAUCUACCG, the antisense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGCAUCUACCG is The kit has the characteristics of high sensitivity, strong specificity, short period and the like, is beneficial to early diagnosis and treatment of the clear cell renal carcinoma, and has the potential of becoming a novel biomarker and an effective treatment target in the clear cell renal carcinoma.

The present invention is directed to methods and compositions employing elesclomol or derivatives or analogs thereof for treatment of malignancies, in particular ovarian clear-cell carcinoma (OCCC), more particularly, OCCC that has progressed beyond FIGO stage 1 or has metastasized.

The invention relates to the field of medical image processing, and particularly discloses a TLS structure sketching system and method based on artificial intelligence, and the method comprises the steps: S1, image preprocessing: carrying out the standardization processing of an input HE staining section image, firstly separating cell nucleus and cytoplasm staining components through a color deconvolution algorithm, and highlighting the nucleoplasm contrast of lymphocytes; then strengthening the cell contour boundary by adopting an edge detection algorithm, and connecting the fracture edge through morphological operation to form a continuous and clear cell boundary mask; s2, morphological feature extraction: performing single cell segmentation based on the preprocessed image, and extracting geometric features and texture features of each cell; through machine learning model training, distinguishing lymphocytes and non-lymphocytes according to the characteristics, and generating a lymphocyte distribution probability graph; and S3, preliminarily identifying the aggregated area. By adopting the technical scheme of the invention, the TLSs differentiation stage can be identified, and the identification accuracy can be improved by combining morphological characteristics and spatial distribution characteristics.

The application discloses application of a reagent for detecting AHSP protein in preparation of a product for diagnosing prostate cancer, and relates to the technical field of biological medicine; through proteomic analysis, ELISA test on urine protein of prostate cancer patients, clear cell renal cell carcinoma patients and normal healthy men, and immunohistochemical analysis on file wax blocks of the prostate cancer patients, normal prostate tissues around the cancer, prostate tissues of prostatic hyperplasia and clear cell renal cell carcinoma tissues, it is found that the AHSP protein has a certain relationship with the occurrence and development of prostate cancer, and can be used for assisting diagnosis of the prostate cancer; and in urine detection, AHSP has higher sensitivity than PSA, and when PSA is negative or serum PSA is low, AHSP can form complementation with ASHP, thereby helping to improve the diagnosis rate and non-invasive screening ability; through research on the relationship between the AHSP protein and the prostate cancer, the diagnosis rate of patients can be improved, non-invasive reexamination after treatment is facilitated, drug use is guided, and the survival rate is improved.

Provided herein is technology for ovarian cancer screening and particularly, but not exclusively, to methods, compositions, and related uses for detecting the presence of ovarian cancer and sub-types of ovarian cancer (e.g., clear cell ovarian cancer, endometrioid ovarian cancer, mucinous ovarian cancer, serous ovarian cancer).

This invention relates to a sample processing reagent and its application in flow cytometry analysis, belonging to the field of flow cytometry analysis technology. The invention provides a sample processing reagent comprising a hemolysin and a cell-permeable agent. The hemolysin comprises tris(hydroxymethyl)aminomethane (Tris), sodium chloride, calcium chloride, disodium ethylenediaminetetraacetate, paraformaldehyde, and a solvent. The cell-permeable agent comprises sodium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, nonylphenol polyoxyethylene ether, Triton X-100, paraformaldehyde, and a solvent. The hemolysin is mild and highly effective, providing complete hemolysis and clear cell clustering. The cell-permeable agent permeates the cell membrane under isotonic and neutral conditions, minimizing damage to cell surface antigens and effectively detecting both cytoplasmic and nuclear antigens.

The invention discloses an improvement method of a gastrointestinal tissue frozen section. Aiming at the problems of long freezing time, easy formation of ice crystals, cell edema, many cracks and poor slice quality of a traditional method (standing and quick-freezing for 3 minutes at-20 DEG C to-30 DEG C after OCT embedding), the method comprises the following steps: pre-cooling a freezing head, trimming into a horizontal platform, placing gastrointestinal tissues in the center of the platform, limiting the shape by using a 3mm steel ring, and pressurizing and quickly freezing by using a freezing hammer (8-10 seconds) after OCT is dropwise added, and then directly slicing and staining. The method greatly shortens freezing time, reduces ice crystal damage, is clear in cell morphology and complete in section, improves diagnosis accuracy, is simple and convenient to operate, and is suitable for clinical rapid diagnosis requirements.

The present invention relates to a composition comprising a skin keratinocyte-derived extracellular matrix as an active ingredient as an active ingredient for the prevention, alleviation, or treatment of cancer. The composition for preventing, alleviating, or treating cancer of the present invention contains an extracellular matrix derived from skin keratinocytes as an active ingredient, thereby significantly reducing only the proliferation of cancer cells without exhibiting side effects such as cytotoxicity in normal cells such as fibroblasts constituting the dermis of normal skin. In addition, the composition for preventing, alleviating, or treating cancer of the present invention was observed to: have the effect of suppressing the proliferation of MDA-MB-231, which cannot be expected to be greatly responsive to targeted therapies and currently lacks effective treatments, in addition to MCF7 among breast cancer cells; be able to remarkably inhibit the proliferation of Caki-1 and Caki-2, which are clear cell carcinomas classified as intractable cancer among kidney cancer cells and known to have many distant metastasis recurrences; and significantly reduce the proliferation of PANC-1, which is a pancreatic cancer cell line classified as refractory cancer that is difficult to detect early among cancer cells and is found in the late stage when surgery and treatment are limited, as well as having low treatment responsiveness to the latest immunotherapy drugs and low treatment responsiveness to targeted therapy and traditional chemotherapy. Furthermore, the composition for preventing, alleviating, or treating cancer of the present invention can be applied not only to breast cancer, kidney cancer, and pancreatic cancer, but also to the treatment of various carcinomas and solid cancers occurring on the skin. Moreover, the composition for preventing, alleviating, or treating cancer of the present invention can be used as a therapeutic agent in combination with other anticancer agents. Additionally, the composition for preventing, alleviating, or treating cancer of the present invention can be used in a treatment method for reducing the size of cancer before surgery without side effects, unlike traditional chemotherapy, through intratumoral injection.

Provided herein is technology for ovarian cancer screening and particularly, but not exclusively, to methods, compositions, and related uses for detecting the presence of ovarian cancer and sub-types of ovarian cancer (e.g., clear cell ovarian cancer, endometrioid ovarian cancer, mucinous ovarian cancer, serous ovarian cancer). As described herein, the technology provides a number of methylated DNA markers and subsets thereof (e.g., sets of 2, 3, 4, 5, 6, 7, or 8 markers) with high discrimination for ovarian cancer overall and various types of ovarian cancer (e.g., clear cell OC, endometrioid OC, mucinous OC, serous OC).

The invention belongs to the field of fish immunology, and relates to a rat anti-grass carp CD8 alpha monoclonal antibody capable of identifying grass carp CD8 + T cells, a hybridoma cell strain and application. The CDR sequence of a heavy chain variable region of the monoclonal antibody is as shown in SEQ ID NO.1-3, the CDR sequence of a light chain variable region of the monoclonal antibody is as shown in SEQ ID NO.4-6, and the monoclonal antibody can be secreted by a hybridoma cell strain with the preservation number of CCTCC NO: C2025329. The monoclonal antibody disclosed by the invention can be used for identifying the grass carp CD8 + T cells with high specificity and high sensitivity in a flow cytometry and the like, the cell grouping is obvious, and an important tool is provided for subsequently and deeply developing action mechanism research of the CD8 + T cells in grass carp immune response and grass carp vaccine effect evaluation.

The invention discloses an automatic grading and classifying method for progressive kidney cancer based on DCCD subtype markers, which comprises the following steps: taking a TGFBI gene, a PLOD2 gene and an SLC2A1 gene as marker genes of DCCD subtype renal clear cell carcinoma tissue samples subjected to clear cell differentiation to obtain an immunohistochemical staining image of a marker gene antibody corresponding to each renal clear cell carcinoma tissue sample; obtaining a staining intensity score of each immunohistochemical staining image of each renal clear cell carcinoma tissue sample; performing image segmentation and cell counting on the immunohistochemical staining image corresponding to each renal clear cell carcinoma tissue sample to obtain a positive cell proportion score corresponding to each renal clear cell carcinoma tissue sample; classifying the renal clear cell carcinoma tissue sample as a progressive renal clear cell carcinoma patient or a non-progressive renal clear cell carcinoma based on the DCCD score; according to the invention, rapid and accurate screening of progressive renal clear cell carcinoma patients is realized, the realization mode is simple, and the cost is low.

The present disclosure relates to a method of identifying a female human subject that has developed or is likely to develop endometriosis. The present disclosure further relates to a method of identifying a female human subject that should be administered a NTRK inhibitor, including a selective NTRK2 inhibitor, to treat, ameliorate, and / or prevent endometriosis. The present disclosure further relates to a method of identifying a female human subject that should be administered a NTRK inhibitor, including a selective NTRK2 inhibitor, to treat, ameliorate, and / or prevent endometriosis and the consequences of endometriosis, such as cancer (e.g., clear cell ovarian cancer and / or endometroid ovarian cancer).

Provided herein is technology for ovarian cancer screening and particularly, but not exclusively, to methods, compositions, and related uses for detecting the presence of ovarian cancer and sub-types of ovarian cancer (e.g., clear cell ovarian cancer, endometrioid ovarian cancer, mucinous ovarian cancer, serous ovarian cancer).

The invention belongs to the field of biological medicine, and particularly relates to application of metformin in preparation of a medicine for treating cataract. The invention provides application of metformin in preparation of a medicine for preventing and / or treating cataract. Meanwhile, the invention provides a preparation for preventing and / or treating cataract, and the preparation contains metformin. It is found that metformin has a protective effect on lens epithelial cells, oxidative damage and apoptosis of the lens epithelial cells in an oxidative stress environment can be effectively resisted, and the key effect of SIRT1 / FOXO1 signal channel mediated autophagy in metformin is defined. A clear cell molecular mechanism is provided for treating age-related cataract by using metformin, and the metformin is expected to become a safe and effective medicine for treating cataract.

This invention discloses the application of reagents for detecting REEP protein in the preparation of products for diagnosing prostate cancer, relating to the field of biomedical technology. Through proteomic analysis, ELISA assays, and immunohistochemical analysis of urinary proteins from prostate cancer patients, clear cell renal cell carcinoma patients, urothelial carcinoma patients, and healthy individuals, as well as paraffin-embedded tissue samples from prostate cancer patients and surrounding normal prostate tissue, urothelial carcinoma tissue, and clear cell renal cell carcinoma tissue, it was found that REEP6 and REEP5 proteins are related to the occurrence and development of prostate cancer and can be used to assist in the diagnosis of prostate cancer. Furthermore, in urinary testing, REEP6 and REEP5 have higher sensitivity compared to PSA, and the three proteins can complement each other, thus helping to improve the diagnostic rate and non-invasive screening capabilities. Research on the relationship between REEP6 and REEP5 proteins and prostate cancer facilitates non-invasive follow-up after treatment and guides medication, thereby improving survival rates.

The invention relates to the technical field of cell gene analysis, in particular to a method for marking renal clear cells by sialyltransferase gene signatures with a non-disease diagnosis purpose and application of the method. The method comprises the following steps: firstly, collecting a cell sample, screening candidate genes through multiple change and t test, and then carrying out feature selection and model construction by utilizing a random forest algorithm; according to the process, the limitation of a traditional method in the aspects of high-dimensional gene data processing and feature selection is solved, the gene expression difference can be comprehensively evaluated from the whole genome level, and the gene combination with the most distinguishing property can be recognized; and finally, model verification is performed through a cell verification set and multiple change, so that the reliability of a prediction result is ensured. According to the method, multiple advanced analysis technologies are integrated, the accuracy and efficiency of renal clear cell marking are improved, and an innovative analysis normal form is provided for related research.