Use of PD-L1 spliceosome B as a marker to guide the dosing of anti-PD-L1/PD1 immunotherapy

An immunotherapy, PD-L1 technology, applied in the field of biomedicine and tumor immunotherapy, can solve the problems that no research has shown the role and mechanism of the three splice bodies, and no research has shown the role of cancer

Active Publication Date: 2020-10-30
ZHEJIANG UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] It has been disclosed in the prior art that there are three alternative splicing bodies (isoforms) of PD-L1, namely Isoform a, Isoform b, and Isoform c, but only the existence of the three splicing bodies is disclosed, and no research has shown that the three splicing bodies exist in In vivo action and mechanism, and no studies have shown its role in a specific cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of PD-L1 spliceosome B as a marker to guide the dosing of anti-PD-L1/PD1 immunotherapy
  • Use of PD-L1 spliceosome B as a marker to guide the dosing of anti-PD-L1/PD1 immunotherapy
  • Use of PD-L1 spliceosome B as a marker to guide the dosing of anti-PD-L1/PD1 immunotherapy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0159] Example 1 Analysis of the expression of PD-L1 in colorectal cancer cell lines

[0160] All colorectal cancer cell lines in the laboratory were collected for PD-L1 western bolt detection, and the results were as follows Figure 3a shown. Among them, the antibody of PD-L1 is Abcam Company: Anti-PD-L1 antibody [28-8] (ab205921). It can be seen from the figure that among the common cell lines of colorectal cancer, only RKO and RKO-MUT cell lines have PD-L1 expression. Among them, RKO-MUT cells are mutant cells of RKO cells, which are preserved by the pathology laboratory of Zhejiang University School of Medicine. The inventor promises that the cells can provide the cell line to the public free of charge within 20 years from the date of patent application.

Embodiment 2

[0161] Example 2 RNAi interferes with the expression of PD-L1 of RKO / RKO-MUT

[0162] Detection of PD-L1 expression in RNAi RKO / RKO-MUT cell lines, in which the siRNA sequences used are shown in the table below:

[0163]

[0164]

[0165] The result is as Figure 3b shown. It can be seen from the figure that after RNAi, the expression of PD-L1 in RKO / RKO-MUT cells decreased, and the expression of PD-L1 in RKO cell lines decreased more significantly than in RKO-MUT cell lines. In addition, surprisingly, the inventors observed that the band position of PD-L1 in the RKO-MUT cell line is different from that in the RKO cell line, suggesting that there may be multiple alternative splicing forms of PD-L1. After retrieval, Homo sapiens PD-L1 protein has three natural alternative splicing forms, namely isoforma / b / c, and the comparison relationship between the encoded nucleotide sequences can be seen in Figure 1, and the encoded polypeptide The sequences can be found in NCBI ac...

Embodiment 3

[0166] Example 3 RT-qPCR detection of the expression of three splice bodies in different colorectal cancer cell lines

[0167] Primers were designed in the common sequence regions of the 3 variants, and all 3 variants could be detected; primers were designed for the 3 variants, and only a specific variant could be detected. The mRNA expression of the three variants was detected by qPCR, and the primer sequences are shown in the table below:

[0168] Primer name sequence(5'to3') SEQ ID NO: PDL1-qPCR-F GCCGAAGTCATCTGGACAAG 10 PDL1-qPCR-R AGTGTGCTGGTCACATTGAA 11 PDL1-a-F ATGCTGCACTTCAGATCACAGA 12 PDL1-a-R TCACATCCATCATTCTCCCTTTT 13 PDL1-b-F GGCATTTGCTGAACGCCCC 14 PDL1-b-R TGCTTGTCCAGATGACTTCGG 15 PDL1-c-F TGATCAGCTATGGTGGTGCC 16 PDL1-c-R GTGCTAGGGGACAGTGTTAGA 17 β-actin-F GTCATTCCAAATATGAGATGCGT 18 β-actin-R GCTATCACCTCCCCTGTGTG 19

[0169] The result is as Figure 4 As shown, simil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a PD-L1 (Programmed Death-Ligand 1) spliceosome B as a marker for instructing administration of PD-L1 / PD1 immunotherapy. Expression of three different variable spliceosomes of PD-L1 can be observed in normal and mutant colorectal cancer cell systems, and eukaryotic expression vectors of the three spliceosomes are established and transfected into tumor cells without or with low PD-L1 expression. Tests further show that in co-culture of a tumor cell system with isoform b over-expression and immune cells, apoptosis of the immune cells is promoted, secretionof immune cell factors is inhibited, inhibition of immunoreactions in bodies of patients can be reminded, and clinical sample testing shows that isoform b of PD-L1 is a monitoring target of poor prognosis of tumor.

Description

technical field [0001] The invention relates to the application of a PD-L1 splice body in guiding tumor immunotherapy medication, which belongs to the field of biomedicine, specifically the field of tumor immunotherapy. Background technique [0002] In recent years, anti-programmed death growth factor-1 (programmed death-1, PD-1 / CD279) / programmed death ligand-1 (programmed death ligand-1, PD-L1 / CD274) pathway immune checkpoint blockade Anticancer agents are a research hotspot in antitumor therapy. At present, atezolizumab, nivolumab, pembrolizumab and other reagents have been applied to clinical trials of malignant tumors such as melanoma, non-small cell lung cancer, and colorectal cancer (CRC), and have achieved certain therapeutic effects[1]. Among them, colorectal cancer is the third most common cancer in the world, and its fatality rate ranks fourth among malignant tumors, so research on its diagnosis and treatment is imminent. [0003] PD-L1 is a potential indicator f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/158
Inventor 张红河王超彦翁梦涵来茂德
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products