Novel xylanase

A new technology of xylanase, applied in the field of genetic engineering, can solve the problems of restricting large-scale applications

Inactive Publication Date: 2018-11-27
邵玉芹
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, xylan, an anti-nutritional factor, exists in by-products such as wheat, grains and bran, which limits its large-scale application in feed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel xylanase
  • Novel xylanase
  • Novel xylanase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1, the cloning of Xyn-dx gene and the construction of recombinant plasmid pET-30a / Xyn-dx

[0022] The cloning method of Xyn-dx xylanase gene is as follows:

[0023] ① Design primers containing two restriction enzyme sites of EcoR I and Xho I:

[0024] LXY-F: 5'CCGGAATTCATGCGCCCCGTAGACTAT 3', the nucleotide sequence is shown in SEQ ID No.3,

[0025] LXY-R: 5'CCGCTCGAGGATCATTCTTATTCTAAA 3', the nucleotide sequence is shown in SEQ ID No.4.

[0026] ②PCR amplification of the pre-prepared positive plasmid of the Xyn-dx gene (the Xyn-dx carried on the plasmid is obtained by screening the microbiota construction library in the rumen of the cow), and the amplification conditions of the Xyn-dx gene are as follows: 94 Pre-denaturation at ℃ for 2 minutes; denaturation at 94℃ for 30s, annealing at 58℃ for 30s, extension at 72℃ for 45s, a total of 30 cycles; in the 30th cycle, extension at 72℃ for 10min, PCR products were identified by gel electrophoresis, recovered by ...

Embodiment 2

[0030] Embodiment 2, the expression of recombinant plasmid in escherichia coli

[0031] Heat shock transformation Take 10 μl of the ligation product and mix it carefully with E. coli competent BL21(DE3), and put it in an ice bath for 30 minutes; heat shock it in a water bath at 42°C for 60 seconds, and immediately take it out of the ice bath for 2-3 minutes; add 900 μl of SOC solution preheated at 37°C, 150rpm Incubate at a constant temperature for 1 hour; absorb 50 μl of the transformed bacterial solution, apply it to a screening medium containing kanamycin, and incubate at a constant temperature at 37°C for 15 hours; pick plaques for PCR identification of the bacterial solution, and transfer the positive clones to Expand culture in LB liquid medium containing kanamycin.

Embodiment 3

[0032] Embodiment 3, induction and purification of positive bacterial strains

[0033] ①Induction of positive strains

[0034] Pipette 10 μl of positive bacterial liquid and transfer to 5 mL LB liquid medium containing kanamycin (100 μg / mL), and culture at 37° C., 220 rpm for 16 hours.

[0035] Transfer 5 mL of bacterial liquid to 100 mL of LB liquid medium, and continue culturing at 37° C. and 220 rpm until OD=0.8 (about 8 hours).

[0036] Add 100 μl IPTG (final concentration 1 mmol / L), induce culture at 25° C., 150 rpm for 12 hours at low temperature.

[0037] Transfer the induced bacterial solution to a 50 mL centrifuge tube, centrifuge at 12000 rpm at 4°C for 15 min, discard the supernatant, and add 20 mL of PBS buffer (pH7.4) to fully resuspend the bacterial cells.

[0038] Put it into a beaker filled with ice cubes, and repeat ultrasonic crushing twice (15 min each time, 3 s working time, 5 s intermittent time, No. 6 horn, 195 W crushing power).

[0039] The crushed b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of genetic engineering, in particular to novel xylanase Xyn-dx and application thereof. The nucleotide sequence of the novel xylanase Xyn-dx is as shown in SEQ ID No. 1, and the amino acid sequence of the novel xylanase Xyn-dx is as shown in SEQ ID No. 2. The optimum pH of the novel xylanase Xyn-dx is 8.5, the optimum temperature of the novel xylanase Xyn-dx is 70 DEG C, and the novel xylanase Xyn-dx is good in pH stability and thermal stability. The novel xylanase Xyn-dx serving as a novel enzyme preparation is widely applicable to papermaking, feed additives and the like.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a xylanase coding gene and application thereof. Background technique [0002] Xylan is a poly-five-carbon sugar and an important component of hemicellulose. It is the second most abundant polysaccharide in nature after cellulose and accounts for almost one-third of the earth's renewable organic carbon content. Xylan widely exists in bark, fruit, wood, roots, leaves, etc. of plants, and is the most important renewable resource in nature. Xylanase is a general term for a class of enzymes that can degrade xylan into oligosaccharides and xylose. The research on xylanase mainly focuses on xylanases suitable for pulp and paper industry, food industry, energy industry, etc., and a large number of different types of xylanases with different functions have been isolated from microorganisms from different sources . And isolated a variety of xylanase genes, industrial production of a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/53C12N15/70C12N1/21A23K10/14A23K20/189D21H17/00
CPCC12N9/248A23K10/14A23K20/189C12N15/70D21H17/005
Inventor不公告发明人
Owner邵玉芹