Unlock instant, AI-driven research and patent intelligence for your innovation.

Function and application of Klotho-beta

A technology of use and medicine, applied in the field of function and application of Klotho-beta, can solve the problem of no correlation between Klotho-beta and lung cancer, etc., and achieve the effect of inhibiting proliferation and promoting apoptosis

Active Publication Date: 2019-05-07
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There is no correlation report between Klotho-beta and lung cancer in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Function and application of Klotho-beta
  • Function and application of Klotho-beta
  • Function and application of Klotho-beta

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] 1. Experimental method

[0092] 1. Continuously express KLB protein in lung cancer cells by transfecting overexpression lentivirus in lung cancer cells:

[0093] (1) constructing a lentivirus overexpressing KLB;

[0094]1) KLB gene [gene name KLB (NM_175737), species (Human)] obtained by chemical synthesis, the nucleotide sequence of the KLB gene is shown in SEQ ID NO.1, specifically:

[0095] GGCCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGT ACCGGT CGCCACCATGAAGCCAGGCTGTGCGGCAGGATCTCCAGGGAATGAATGGATTTTCTTCAGCACTGATGAAATAACCACACGCTATAGGAATACAATGTCCAACGGGGGATTGCAAAGATCTGTCATCCTGTCAGCACTTATTCTGCTACGAGCTGTTACTGGATTCTCTGGAGATGGAAGAGCTATATGGTCTAAAAATCCTAATTTTACTCCGGTAAATGAAAGTCAGCTGTTTCTCTATGACACTTTCCCTAAAAACTTTTTCTGGGGTATTGGGACTGGAGCATTGCAAGTGGAAGGGAGTTGGAAGAAGGATGGAAAAGGACCTTCTATATGGGATCATTTCATCCACACACACCTTAAAAATGTCAGCAGCACGAATGGTTCCAGTGACAGTTATATTTTTCTGGAAAAAGACTTATCAGCCCTGGATTTTATAGGAGTTTCTTTTTATCAATTTTCAATTTCCTGGCCAAGGCTTTTCCCCGATGGAATAGTAACAGTTGCCAAC...

Embodiment 2

[0133] This example is the test and data of down-regulating KLB siRNA in lung cancer cells to lower the expression of β-klotho.

[0134] The siRNA that down-regulates KLB in reverse used in this example was purchased from life technology.

[0135] siRNA that down-regulates KLB in cis-rotation:

[0136] Forward sequence: CCACACGUAUAGGAAUACtt (SEQ ID NO.2);

[0137] Reverse sequence: GUAUUCCUAUAGCGUGUGGtt (SEQ ID NO.3);

[0138] experiment process:

[0139] (1) Cell plating 2*10 5 cells per well into a six-well plate;

[0140] (2) 24 hours after the cells adhere to the wall, use RNAimax (purchased from life technology) to transfect siRNA;

[0141] (3) After 24 hours, the cells were replaced with 1mM H 2 0 2 Cells were treated; cell apoptosis was detected by flow cytometry after 6 hours.

[0142] Such as Figure 5 Experimental description: siRNA (purchased from life technology) that down-regulates KLB can significantly inhibit the expression level of KLB in lung cancer c...

Embodiment 3

[0144] This example is an animal experiment of KLB overexpression.

[0145] 4-week-old male nude mice were purchased from Shanghai Lingchang Biotechnology Co., Ltd. In order to ensure the consistency of tumor size in mice, the method of subcutaneous tumor formation and secondary tumor formation was adopted. The specific operations are as follows:

[0146] Subcutaneous injection of HCC15 human lung squamous cell carcinoma cells 5X10 in mice 6 , a subcutaneous tumor with a diameter of 1cm formed around the tumor;

[0147] The subcutaneous tumor was taken out, cut into small pieces with a diameter of 3mm, and re-sutured to a new subcutaneous tumor of a new mouse, a total of 14 mice;

[0148] After 3 days, the suture thread fell off, and the intratumoral injection of the lentivirus overexpressing KLB and its control virus (the same lentivirus and its control virus used in Example 1) was started, and the treatment time points were as follows Figure 6 Shown; Weigh the body weight...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the medical field of molecular organisms, and particularly relates to a function and application of Klotho-beta. Modern molecular organism experiments prove that KLB is exogenously added, so that proliferation of tumor cells can be restrained, and besides, apoptosis of the tumor cells can be promoted. A new target point and thought are provided for treatment of tumors.

Description

technical field [0001] The invention belongs to the field of molecular biomedicine, and specifically relates to the function and application of Klotho-beta. Background technique [0002] Lung cancer accounts for 1 / 3 of all tumors. There are 1.8 million new cases every year, and 1.6 million patients die of lung cancer every year. On average, one out of every four cancer patients is fatal due to lung cancer. The morbidity and mortality of lung cancer have surpassed male prostate cancer and female breast cancer, becoming the number one killer of cancer in the world today, and its five-year survival rate is less than 15%. 85%-90% of lung cancer patients are caused by smoking. Both first-hand smoke and second-hand smoke can cause lung cancer. In addition, lung cancer patients are getting younger and younger. Although there are currently many treatment options, such as surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy, most of the lung cancer patients are d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K38/16A61K45/00A61P35/00
Inventor 夏伟梁李凡
Owner SHANGHAI JIAO TONG UNIV