Function and application of Klotho-beta
A technology of use and medicine, applied in the field of function and application of Klotho-beta, can solve the problem of no correlation between Klotho-beta and lung cancer, etc., and achieve the effect of inhibiting proliferation and promoting apoptosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] 1. Experimental method
[0092] 1. Continuously express KLB protein in lung cancer cells by transfecting overexpression lentivirus in lung cancer cells:
[0093] (1) constructing a lentivirus overexpressing KLB;
[0094]1) KLB gene [gene name KLB (NM_175737), species (Human)] obtained by chemical synthesis, the nucleotide sequence of the KLB gene is shown in SEQ ID NO.1, specifically:
[0095] GGCCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGT ACCGGT CGCCACCATGAAGCCAGGCTGTGCGGCAGGATCTCCAGGGAATGAATGGATTTTCTTCAGCACTGATGAAATAACCACACGCTATAGGAATACAATGTCCAACGGGGGATTGCAAAGATCTGTCATCCTGTCAGCACTTATTCTGCTACGAGCTGTTACTGGATTCTCTGGAGATGGAAGAGCTATATGGTCTAAAAATCCTAATTTTACTCCGGTAAATGAAAGTCAGCTGTTTCTCTATGACACTTTCCCTAAAAACTTTTTCTGGGGTATTGGGACTGGAGCATTGCAAGTGGAAGGGAGTTGGAAGAAGGATGGAAAAGGACCTTCTATATGGGATCATTTCATCCACACACACCTTAAAAATGTCAGCAGCACGAATGGTTCCAGTGACAGTTATATTTTTCTGGAAAAAGACTTATCAGCCCTGGATTTTATAGGAGTTTCTTTTTATCAATTTTCAATTTCCTGGCCAAGGCTTTTCCCCGATGGAATAGTAACAGTTGCCAAC...
Embodiment 2
[0133] This example is the test and data of down-regulating KLB siRNA in lung cancer cells to lower the expression of β-klotho.
[0134] The siRNA that down-regulates KLB in reverse used in this example was purchased from life technology.
[0135] siRNA that down-regulates KLB in cis-rotation:
[0136] Forward sequence: CCACACGUAUAGGAAUACtt (SEQ ID NO.2);
[0137] Reverse sequence: GUAUUCCUAUAGCGUGUGGtt (SEQ ID NO.3);
[0138] experiment process:
[0139] (1) Cell plating 2*10 5 cells per well into a six-well plate;
[0140] (2) 24 hours after the cells adhere to the wall, use RNAimax (purchased from life technology) to transfect siRNA;
[0141] (3) After 24 hours, the cells were replaced with 1mM H 2 0 2 Cells were treated; cell apoptosis was detected by flow cytometry after 6 hours.
[0142] Such as Figure 5 Experimental description: siRNA (purchased from life technology) that down-regulates KLB can significantly inhibit the expression level of KLB in lung cancer c...
Embodiment 3
[0144] This example is an animal experiment of KLB overexpression.
[0145] 4-week-old male nude mice were purchased from Shanghai Lingchang Biotechnology Co., Ltd. In order to ensure the consistency of tumor size in mice, the method of subcutaneous tumor formation and secondary tumor formation was adopted. The specific operations are as follows:
[0146] Subcutaneous injection of HCC15 human lung squamous cell carcinoma cells 5X10 in mice 6 , a subcutaneous tumor with a diameter of 1cm formed around the tumor;
[0147] The subcutaneous tumor was taken out, cut into small pieces with a diameter of 3mm, and re-sutured to a new subcutaneous tumor of a new mouse, a total of 14 mice;
[0148] After 3 days, the suture thread fell off, and the intratumoral injection of the lentivirus overexpressing KLB and its control virus (the same lentivirus and its control virus used in Example 1) was started, and the treatment time points were as follows Figure 6 Shown; Weigh the body weight...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


