Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of mir-497-5p in the preparation of drugs for promoting the differentiation of scaps

A technology of drugs and accelerators, which is applied in the field of preparation of drugs to promote the differentiation of SCAPs, can solve the problems of unreported, unclear regulation mechanism of proliferation and differentiation, etc.

Active Publication Date: 2020-08-14
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, SCAPs are the key cells to maintain root development and dentin formation, and the regulation mechanism of their proliferation and differentiation is still unclear.
[0004] miRNA is a kind of endogenous, non-coding small molecule single-stranded RNA, about 21-23 nucleotides in length, complementary to the 3' untranslated region (3'UTR) of specific mRNA, resulting in mRNA degradation or inhibition of mRNA It is translated into protein, plays a post-transcriptional role in regulating gene expression, and participates in biological processes such as cell proliferation, differentiation, development, and apoptosis. At present, there is no report on the role of miR-497-5p in the differentiation of SCAPs into dentin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of mir-497-5p in the preparation of drugs for promoting the differentiation of scaps
  • Application of mir-497-5p in the preparation of drugs for promoting the differentiation of scaps
  • Application of mir-497-5p in the preparation of drugs for promoting the differentiation of scaps

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Study on the expression change of miR-497-5p during the differentiation of SCAPs into odontogenic and its correlation with the expression of mineralization proteins such as DSPP

[0035] Isolation, cultivation and identification of biological characteristics of SCAPs.

[0036]①The undeveloped third permanent molars (14-20 years old) whose roots were extracted due to the need of orthodontic treatment in the Stomatological Hospital of Shandong University were selected. Informed consent was obtained from the patients and their parents, and the study was approved by the Ethics Committee of the Stomatological Hospital of Shandong University. According to the enzymatic digestion method used by the applicant in the past, the primary and passage cells were isolated and cultured (please refer to the published literature: Proliferation and osteo / odontogenic differentiation of stem cells from apical papilla regulated by Zinc fingers and homeoboxes 2: An in vitro study); ...

Embodiment 2

[0042] Example 2 Research on the role of miR-497-5p in regulating the osteogenesis / odontogenic differentiation of SCAPs

[0043] To study the effect of miR-497-5p interference / overexpression on the differentiation of SCAPs into odontogenic

[0044] Utilize Lipofectamine2000 to synthesize miR-497-5p promoter miR-497-5p mimics (upstream primer sequence is: CAGCAGCACACUGUGGUUUGU, as shown in SEQ ID NO.1; downstream primer sequence is: AAACCACAGUGUGCUGCUGUU, as shown in SEQ ID NO.2) shown); miR-497-5p inhibitor miR-497-5p inhibitor (its primer sequence is: ACAAACCACAGUGUGCUGCUG, as shown in SEQ ID NO.3) and its negative control were transfected into SCAPs, and then induced by osteogenesis / dentin Induction, to study the effect of miR-497-5p interference / overexpression on cell odontoblast differentiation, to clarify its function, test content:

[0045] The expression of miR-497-5p was detected by qPCR to verify the efficiency of promoting or inhibiting the expression of miR-497-5p:...

Embodiment 3

[0048] Example 3 Prediction and screening of target genes regulated by miR-497-5p and research on its mechanism of action

[0049] ① Prediction and screening of target genes

[0050] Using the databases TargetScan, miRanda, miRecords, miRWalk to predict and screen the target genes of miR-497-5p, it was found that the 3'UTR of the TGF-β / Smad pathway inhibitor Smurf2 has a target site of miR-497-5p, and the follow-up experiments were carried out verify.

[0051] ② Verify the target gene to clarify the effect of miR-497-5p on the expression of the target gene

[0052] SCAPs with stable interference / overexpression of miR-497-5p were induced into osteogenesis / odontogenic orientation, and the expression changes of Smurf2 were detected to clarify the effect of miR-497-5p expression changes on the expression of target genes during the differentiation of SCAPs into odontogenic differentiation. impact. It can be seen from experiments that overexpression of miR-497-5p down-regulates t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnologies and particularly relates to application of miR-497-5p in preparation in drugs for promoting differentiation of SCAPs. The upregulation of expression of miR-497-5p in odontogenic differentiation of the SCAPs is found for the first time in the invention, and a TGF-beta signal channel is regulated and controlled by targeting Smurf2, and odontogenic differentiation of the SCAPs is regulated and controlled. In addition, it is found that the miR-497-5p can also promote the osteogenic differentiation of the SCAPs.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of miR-497-5p in the preparation of drugs for promoting the differentiation of SCAPs. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Stem cells from apical papilla (SCAPs) are key cells in the formation of root pulp dentin, and the regulation mechanism of their proliferation and differentiation is still unclear. Apical papilla stem cells exist in the apical papilla tissue at the end of the apex of developing human permanent teeth, which was first discovered by Sonoyama W et al. in 2008. SCAPs have high proliferation, self-renewal and multi-lineage dif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/7105A61K48/00A61P1/02
Inventor 王燕刘峻青
Owner SHANDONG UNIV