Supercharge Your Innovation With Domain-Expert AI Agents!

Primer set and kit for detecting beta thalassemia

A technology of thalassemia and kits, which is applied in biochemical equipment and methods, recombinant DNA technology, microbiological determination/inspection, etc., can solve the problem of high cost of β-thalassemia detection, low detection throughput, and human factors affecting the interpretation of results Large and other problems, to achieve the effect of low DNA sample volume and quality requirements, high sample throughput, and high accuracy

Pending Publication Date: 2019-08-06
深圳市卫生健康发展研究中心
View PDF7 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a primer set and kit for detecting β-thalassemia, which aims to solve the existing tec

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set and kit for detecting beta thalassemia
  • Primer set and kit for detecting beta thalassemia
  • Primer set and kit for detecting beta thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Primer Design

[0026] (1) Obtain the gene sequence related to β-thalassemia by RS number; among them, IVS I-1 (G>T) / IVS I-1 (G>A) is the same sequence, namely rs33971440. The 15 RS numbers are as follows:

[0027] rs33915217:

[0028] GGCAGAGAGAGTCAGTGCCTATCAGAAACCCAAGAGTCTTCTCTGTCTCCACATGCCCAGTTTCTATTGGTCTCCTAAACCTGTCTTGTAACCTTGATA [C / A / G / T] CAACCTGCCCAGGGCCTCACCACCAACTTCATCCACGTTCACCTTGCCCCACAGGGCAGTAACGGCAGACTTCTCTCAGGAGTCAGATGCACCATGGTG.

[0029] rs33971440:

[0030] GAGAGAGTCAGTGCCTATCAGAAACCCAAGAGTCTTCTCTGTCTCCACATGCCCAGTTTCTATTGGTCTCCTAAACCTGTCTTGTAACCTTGATACCAA [C / A / T] CTGCCCAGGGCCTCACCACCAACTTCATCCACGTTCACCTTGCCCCACAGGGCAGTAACGGCAGACTTCTCTCAGGAGTCAGATGCACCATGGTGTCTG.

[0031] rs35532010:

[0032] AGTGCCTATCAGAAACCCAAGAGTCTTCTCTGTCTCCACATGCCCAGTTTCTATTGGTCTCCTTAAACCTGTCTTGTAACCTTGATACCAACCTGCCCAG [- / G] GGCCTCACCACCAACTTCATCCACGTTCACCTTGCCCCACAGGGCAGTAACGGCAGACTTCTCTCAGGAGTCAGATGCACCATGGTGTCTGTTTGAGGT.

[0033] rs33950507:

[0034] CTATCAGAAA...

Embodiment 2

[0071] Example 2 Detection of beta thalassemia

[0072] (1) Multiplex PCR reaction: The amplification primers were prepared into a 1 μM mixture, which contained the forward and reverse primers of 16 SNP sites in the multiplex PCR reaction, and the gDNA with β-thalassemia was used as the sample to be tested, diluted to 5 ng / μL, According to the reaction system in Table 3 below, the following reaction program was carried out: 95° C. for 2 minutes; (95° C. for 30 seconds, 56° C. for 30 seconds, 72° C. for 60 seconds) x 45 cycles; 72° C. for 5 minutes. Make two tubes in parallel according to the above steps (respectively the first amplification reaction system and the second amplification reaction system).

[0073] table 3

[0074] Element volume Water, HPLC grade 1.4μL 10x PCR Buffer with 20mM MgCl 2

0.5μL 25mM MgCl 2

0.4μL 25mM dNTP Mix 0.1μL 1uM Primer Mix 0.5μL 5U / μl PCR Enzyme 0.1μL 5ng / μL DNA 2μL Tota...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene detection, and especially relates to a primer set and kit for detecting beta thalassemia. The primer set performs detection based on a MassARRAY mass spectrum platform, and includes amplification primers shown as SEQ ID NO.1-SEQ ID NO.6 and extension primers shown as SEQ ID NO.7-SEQ ID NO.22. The provided primer set can be used for detecting beta thalassemia based on a MassARRAY system; through the design of the amplification primers of multiple PCR amplification systems and the extension primers of corresponding mutation sites on 16 commonkinds of the beta thalassemia for Chinese, mutation site information can be rapidly, accurately and economically detected by utilizing a principle of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; and the primer set has advantages of being high in cost performance, high in accuracy and sensitivity, high in sample flux, and low in DNA sample capacity and quality requirement.

Description

technical field [0001] The invention belongs to the technical field of gene detection, and in particular relates to a primer set and a kit for detecting beta thalassemia. Background technique [0002] β-thalassemia (abbreviated as β-thalassemia, β-mediterranean anemia) is a common clinical hereditary hemolytic anemia, which refers to a group of hemoglobinopathies in which the synthesis of β-chain is partially or completely inhibited. It is mainly caused by a point mutation or deletion in the β gene located in subband 5, subband 4 (11p15.4) of the short arm of chromosome 11. At present, more than 200 types of β-globin gene mutations have been found in the world, and more than 50 types have been found in the Chinese population. Therefore, the genetic defects of β-thalassemia are highly heterogeneous, but there are 6 hotspot mutations: c.126_129delCTTT, c.315+654C>T, c.52A>T, -28A>G, c.217dupA and c.79G>A account for about 90% of the mutation types. According to s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156C12Q2600/16
Inventor 段山
Owner 深圳市卫生健康发展研究中心
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More