Mycobacterium tuberculosis h37rv coding gene and its application
A Mycobacterium tuberculosis and genome technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of gene boundary error, long separation and culture period, difficult annotation gene prediction, etc., and achieve the effect of easy comparison
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Searching for missing annotation coding genes in the H37Rv strain genome
[0036]1.1 High-coverage proteome verification of the H37Rv strain genome
[0037] A deep coverage study of the proteome was performed on the H37Rv strain using high-coverage proteome technology. Based on the Tuberculosis (20160307) database, the genome was annotated and encoded using the pFind 3 engine. In order to discover new protein coding regions, based on proteomics technology, we used pAnno software to translate the six-reading frame database of H37Rv's genome (NC_000962.3) file published by NCBI, and used this database to perform mass spectrometry data for new peptides. Segments and identification of new proteins. In order to reduce the false positive rate, we used three filtering methods for separately estimating category FDR for annotated peptides and new peptides during the data filtering process, namely S-FDR, T-FDR I and T-FDRII.
[0038] After data analysis, we identifi...
Embodiment 2
[0053] Embodiment 2: Establish the method for identifying MTBC complex group
[0054] (1) Design primers:
[0055] Based on the CDS sequence of the Rv0229A (-|274710-274904|) gene shown in SEQ ID NO.1, PCR primers were designed using Oligo7.0, and the primer sequences are as follows:
[0056] F: 5'-GGCATTACCTCTCACATCCAC-3' (SEQ ID NO.4);
[0057] R: 5'-CCTCAGCCAACGGTTCCA-3' (SEQ ID NO.5)
[0058] The positional relationship between the above primers and the Rv0229A (-|274710-274904|) gene is shown below, where the corresponding positions of the primers are underlined, and the gray background is the complete ORF sequence of the missing annotation gene Rv0229A (-|274710-274904|).
[0059] GGCATTACCTCTCACATCCAC AACGACGTCATCCCCGCACTGAAGCAGCACGGCGTCACCGACGAGCAGCTGCACACCATGCTCGTCGACAACCCGCGCCGCATCTTCGAGCGGCAGGGCGGCTATCAGTGAGACAGCCGCGCCGGGCGAATGCCATGGGCTTGGCATTGTGCATATATATCGGCTCCTTATTGATATATACTCCGATTCATGGCGAAACATCTCGTCGACATCGACGAGCAGGCTTTAAACATGGCTCGTACAGAATTGGGCACGACGACGATCAAAGA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com