A molecular approach to modify the flowering rhythm of petunias
A petunia, flowering time technology, applied in the field of molecular biology, can solve problems such as less flowering time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] 1. Carrier construction
[0031] (1) Synthesis of the flower-specific promoter (proCbLIS): The relevant sequence was obtained by searching on NCBI, and the GeneBank ID is AF067601. The synthesis of the sequence (SEQ ID NO: 2) was completed by Yingwei Jieji (Shanghai) Trading Co., Ltd., and the nucleotide product was obtained.
[0032] (2) Construct pK7FWG2.0-proCbLIS empty vector. The flower-specific promoter proCbLIS was passed through the unidirectional restriction endonuclease site S by restriction endonuclease ligation ac I and S pe I replaced the CaMV35S promoter of the expression vector pK7FWG2.0 to obtain the remodeled pK7FWG2.0-proCbLIS expression vector.
[0033] (3) Jasmine circadian clock gene QUR Sequence amplification of jasmine: total RNA was extracted from jasmine, reverse transcribed into cDNA. Design specific primers (5'race GSP1:CCAAAATCCCGAGAAAGGTTGCTGCT; 5'race GSP2:CTGTCCTCTTCTTGGTACTGCTTAGTGTCT; 3'race GSP1:TGGCTTACTCCCATTATGTGCTCCGT; 3'race...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com