Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A molecular approach to modify the flowering rhythm of petunias

A petunia, flowering time technology, applied in the field of molecular biology, can solve problems such as less flowering time

Active Publication Date: 2021-07-20
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most researches are carried out on regulating the development of floral organs and improving flower color, and there are still few studies on flowering time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular approach to modify the flowering rhythm of petunias
  • A molecular approach to modify the flowering rhythm of petunias
  • A molecular approach to modify the flowering rhythm of petunias

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] 1. Carrier construction

[0031] (1) Synthesis of the flower-specific promoter (proCbLIS): The relevant sequence was obtained by searching on NCBI, and the GeneBank ID is AF067601. The synthesis of the sequence (SEQ ID NO: 2) was completed by Yingwei Jieji (Shanghai) Trading Co., Ltd., and the nucleotide product was obtained.

[0032] (2) Construct pK7FWG2.0-proCbLIS empty vector. The flower-specific promoter proCbLIS was passed through the unidirectional restriction endonuclease site S by restriction endonuclease ligation ac I and S pe I replaced the CaMV35S promoter of the expression vector pK7FWG2.0 to obtain the remodeled pK7FWG2.0-proCbLIS expression vector.

[0033] (3) Jasmine circadian clock gene QUR Sequence amplification of jasmine: total RNA was extracted from jasmine, reverse transcribed into cDNA. Design specific primers (5'race GSP1:CCAAAATCCCGAGAAAGGTTGCTGCT; 5'race GSP2:CTGTCCTCTTCTTGGTACTGCTTAGTGTCT; 3'race GSP1:TGGCTTACTCCCATTATGTGCTCCGT; 3'race...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The purpose of the present invention is to provide a molecular method for regulating the flowering time of petunias. The realization method of the present invention is realized by utilizing the molecular method of co-regulating the flowering rhythm of the plant with the flower-specific expression promoter and the biological clock gene, combined with the means of genetic transformation. Including the synthesis of the promoter, the amplification of the LHY gene, the construction of the vector, and the genetic transformation of petunia, an important flower with simple tissue and cell manipulation techniques, a short life cycle, and a clear genetic background, as a transgenic model plant, and finally obtains the occurrence of flowering time Altered transgenic plants. A flower-specific expression promoter was used to promote the expression of the biological clock gene LHY, which can regulate the flowering rhythm of plants, in petunia, and a new variety with a significant difference in the flowering time of the transgenic plants compared with the control was obtained. Through statistics on the flowering time of the obtained positive transgenic plants, it was found that the flowering time of the transgenic lines was delayed by nearly 4 hours compared with the control plants.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular technology for regulating the flowering time of petunia. Background technique [0002] Flowering is an indispensable physiological process for plant reproduction. The control of the plant's own genes and the influence of environmental conditions jointly maintain the plant-the time for transition from vegetative growth to reproductive growth. Higher plants regulate flowering time by sensing seasonal fluctuations in daylight duration. The change in flowering time in response to sunshine duration is jointly regulated by complex environmental signals and time maintenance mechanisms related to the circadian clock. The biological clock is an endogenous mechanism that can generate an external rhythm with a cycle of nearly 24 hours, so that the internal rhythm of the plant itself and the external environmental conditions can achieve time and space coord...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/113C12N15/29A01H5/02A01H6/82
CPCC07K14/415C12N15/827
Inventor 张梦吕美玲伍炳华刘卓毅
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More