Cyprinus carpio ptps gene, coding protein and application
A technology of pet32a-ptps-bl21 and koi, applied in the field of genetic engineering, can solve problems such as unstable koi traits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Cloning of the middle fragment of the ptps gene
[0022] Align the reported ptps sequences obtained from zebrafish (Danio rerio), carp (Cyprinus carpio), goldfish (Carassius auratus) and medaka (oryzias latipes), find relatively conserved regions, and design and clone the middle of koi ptps sequences A pair of degenerate primers for the fragment, the upstream primer is 5'CGACAGCCTGTATGAGATCA3', and the downstream primer is 5'GCCTCCATTAACCTAAAGTTGA 3'; use the cDNA after reverse transcription of koi skin RNA as a template for PCR. The PCR conditions are: 94°C for 3min; 35 cycles of 94°C for 30s, 56°C for 30s, 72°C for 1min; 72°C for 10min; 4°C∞. The gel electrophoresis image after the PCR reaction is shown in figure 1 .
Embodiment 2
[0024] ptps gene 5'RACE and 3'RACE
[0025] Two primers for 5'RACE and 3'RACE were designed according to the obtained intermediate fragment sequences, and the universal primers UPM short and UPM long were used.
[0026] Long primer = 5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3'
[0027] Short primer=5'-CTAATACGACTCACTATAGGGC-3'
[0028] 5' RACE-specific primers are:
[0029] out: 5'GGGCGGGAGAAGCTTCACCATACTC 3';
[0030] in:5'CTCCGCCACCTCGTTCT3';
[0031] 3'RACE-specific primers are:
[0032] out: 5'GCGCCTGCCATCGCTTACACAGCAA3';
[0033]in: 5'TGTGCCGTATTTTGCTGATGTCGT 3';
[0034] PCR was performed using the cDNA after reverse transcription of koi skin RNA as a template. The PCR conditions were: 94°C for 3 min; 30 cycles of 94°C for 30 s, 68°C for 30 s, and 72°C for 3 min; 72°C for 10 min; 4°C∞. The gel electrophoresis image after the PCR reaction is shown in figure 2 A and B in.
Embodiment 3
[0036] Cloning of the ptps ORF
[0037] According to the results of Example 1 and Example 2, a pair of primers for cloning the ptps ORF were designed, the nucleotide sequence of the upstream primer F-ORF was 5'ATGGCGGCTCTGTGGCTCCAGT3', and the nucleotide sequence of the downstream primer R-ORF was 5'TCAGTTGCAGTAGTTCTGCAGG3 ', using the cDNA after reverse transcription of koi skin RNA as a template to do PCR. The PCR conditions are: 94°C for 3min; 35 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 30s; 72°C for 10min; 4°C∞. After PCR, the obtained product was connected with the pMD-19 vector to form pMD-19-ptps. The gel electrophoresis image after the PCR reaction is shown in figure 2 C in
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com