Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cyprinus carpio ptps gene, coding protein and application

A technology of pet32a-ptps-bl21 and koi, applied in the field of genetic engineering, can solve problems such as unstable koi traits

Active Publication Date: 2020-01-21
HENAN NORMAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traits of koi through cross breeding are extremely unstable, and the proportion of koi individuals with high ornamental value is generally 0.01%-0.10%.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cyprinus carpio ptps gene, coding protein and application
  • Cyprinus carpio ptps gene, coding protein and application
  • Cyprinus carpio ptps gene, coding protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Cloning of the middle fragment of the ptps gene

[0022] Align the reported ptps sequences obtained from zebrafish (Danio rerio), carp (Cyprinus carpio), goldfish (Carassius auratus) and medaka (oryzias latipes), find relatively conserved regions, and design and clone the middle of koi ptps sequences A pair of degenerate primers for the fragment, the upstream primer is 5'CGACAGCCTGTATGAGATCA3', and the downstream primer is 5'GCCTCCATTAACCTAAAGTTGA 3'; use the cDNA after reverse transcription of koi skin RNA as a template for PCR. The PCR conditions are: 94°C for 3min; 35 cycles of 94°C for 30s, 56°C for 30s, 72°C for 1min; 72°C for 10min; 4°C∞. The gel electrophoresis image after the PCR reaction is shown in figure 1 .

Embodiment 2

[0024] ptps gene 5'RACE and 3'RACE

[0025] Two primers for 5'RACE and 3'RACE were designed according to the obtained intermediate fragment sequences, and the universal primers UPM short and UPM long were used.

[0026] Long primer = 5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3'

[0027] Short primer=5'-CTAATACGACTCACTATAGGGC-3'

[0028] 5' RACE-specific primers are:

[0029] out: 5'GGGCGGGAGAAGCTTCACCATACTC 3';

[0030] in:5'CTCCGCCACCTCGTTCT3';

[0031] 3'RACE-specific primers are:

[0032] out: 5'GCGCCTGCCATCGCTTACACAGCAA3';

[0033]in: 5'TGTGCCGTATTTTGCTGATGTCGT 3';

[0034] PCR was performed using the cDNA after reverse transcription of koi skin RNA as a template. The PCR conditions were: 94°C for 3 min; 30 cycles of 94°C for 30 s, 68°C for 30 s, and 72°C for 3 min; 72°C for 10 min; 4°C∞. The gel electrophoresis image after the PCR reaction is shown in figure 2 A and B in.

Embodiment 3

[0036] Cloning of the ptps ORF

[0037] According to the results of Example 1 and Example 2, a pair of primers for cloning the ptps ORF were designed, the nucleotide sequence of the upstream primer F-ORF was 5'ATGGCGGCTCTGTGGCTCCAGT3', and the nucleotide sequence of the downstream primer R-ORF was 5'TCAGTTGCAGTAGTTCTGCAGG3 ', using the cDNA after reverse transcription of koi skin RNA as a template to do PCR. The PCR conditions are: 94°C for 3min; 35 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 30s; 72°C for 10min; 4°C∞. After PCR, the obtained product was connected with the pMD-19 vector to form pMD-19-ptps. The gel electrophoresis image after the PCR reaction is shown in figure 2 C in

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cyprinus carpio ptps gene, coding protein and application thereof, and belongs to the technical field of gene engineering. The technical scheme is characterized in that the cyprinus carpio ptps gene has a nucleotide sequence shown in SEQ ID NO:2. The invention further discloses a recombinant expression vector containing the cyprinus carpio ptps gene, a recombinant strainand application in preparation of a mouse primary antibody for detecting PTPS protein of cyprinid fish. The cyprinus carpio ptps gene is obtained by cloning for the first time and constructs the expression vector and the recombinant Escherichia coli strain, a large quantity of expressed recombinant cyprinus carpio PTPS protein in vitro by use of the recombinant Escherichia coli strain, the recombinant cyprinus carpio PTPS protein can be applied to related fields of immunohistochemistry, immunoblotting and Elisa detection of PTPS protein of cyprinid fish.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a koi carp ptps gene, encoded protein and application thereof. Background technique [0002] Body color is one of the important phenotypic traits of fish and is formed by pigment cells. The type, quantity and distribution of pigment cells in fish skin and scales will affect its body color. Pigment cells are formed by differentiation of ectodermal neural crest cells. During embryonic development, neural crest cells differentiate into different cell types including pigment cells along the dorsal-ventral axis. Compared with mammals, which have only one type of melanocytes, fish have six types of pigment cells, including melanocytes, red pigment cells, yellow pigment cells, iridescent cells, blue pigment cells and white pigment cells. [0003] Yellow pigment cells are the most concerned research object after melanocytes. Yellow pigment cells can synthesize...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/70C12N1/21G01N33/68G01N33/573C12R1/19
CPCC12N9/88C12N15/70G01N33/6854G01N33/573C12Y402/03012G01N2333/988Y02A40/81
Inventor 田雪李俊茹董传举王良炎刘慧芬吴利敏宋飞彪马晓王磊张猛李学军
Owner HENAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com