Application of seminal plasma BOLL and reagent kit for diagnosing azoospermia meiosis arrest
A technique of meiosis and azoospermia, applied in the direction of determination/inspection of microorganisms, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] The principles and features of the present invention will be described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only used to explain the present invention and are not intended to limit the scope of the present invention.
[0022] The human gene BOLL (NM_033030.6) is a testis-specific expression, germ cell cycle regulation gene, highly conserved, exists on chromosome 2, belongs to the DAZ gene family, and plays a huge role in the development of human germ cells , its nucleotide sequence is shown in SEQ ID NO:1:
[0023]agctgcgcacgaggccagcggcggggtcgctgccgttgaggcttcccgccactgctgctggcggatttgtggggcaaaatttctcgctggctagccttcttttccctcccgcactttggtggggagggggtggatcctcgtttcggtgcccaagttcacgatgacccgagagaactcgaggaagttgtcgccgcggccatttcccccagtgccgcaacttgctggccttggagggggaggagcgccgaggcagtgactgcgacgcaaacatcaaaccagatgcaaacagattcattatctccatcccctaatcctgtgtcacctgtgcctttgaataacccaacaagtgccccaagatatggaacagtgatccctaatcgcatctttgtaggaggaattga...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


