Application of seminal plasma BOLL and reagent kit for diagnosing azoospermia meiosis arrest

A technique of meiosis and azoospermia, applied in the direction of determination/inspection of microorganisms, biochemical equipment and methods, etc.

Inactive Publication Date: 2020-05-05
HUAZHONG UNIV OF SCI & TECH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, if a non-invasive and accurate method can be found to judge the pathological classification of the tes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of seminal plasma BOLL and reagent kit for diagnosing azoospermia meiosis arrest
  • Application of seminal plasma BOLL and reagent kit for diagnosing azoospermia meiosis arrest
  • Application of seminal plasma BOLL and reagent kit for diagnosing azoospermia meiosis arrest

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] The principles and features of the present invention will be described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only used to explain the present invention and are not intended to limit the scope of the present invention.

[0022] The human gene BOLL (NM_033030.6) is a testis-specific expression, germ cell cycle regulation gene, highly conserved, exists on chromosome 2, belongs to the DAZ gene family, and plays a huge role in the development of human germ cells , its nucleotide sequence is shown in SEQ ID NO:1:

[0023]agctgcgcacgaggccagcggcggggtcgctgccgttgaggcttcccgccactgctgctggcggatttgtggggcaaaatttctcgctggctagccttcttttccctcccgcactttggtggggagggggtggatcctcgtttcggtgcccaagttcacgatgacccgagagaactcgaggaagttgtcgccgcggccatttcccccagtgccgcaacttgctggccttggagggggaggagcgccgaggcagtgactgcgacgcaaacatcaaaccagatgcaaacagattcattatctccatcccctaatcctgtgtcacctgtgcctttgaataacccaacaagtgccccaagatatggaacagtgatccctaatcgcatctttgtaggaggaattga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an application of seminal plasma BOLL to preparation of a reagent for diagnosing azoospermia meiosis arrest, and provides a reagent kit for diagnosing the azoospermia meiosisarrest. The reagent kit provided by the invention is used for detecting the expression level of BOLL in seminal plasma of a patient, so that whether sperms of a NOA patient pass through meiosis or notcan be identified, and whether the NOA patient has meiosis arrest (MA) or passes through the meiosis (non-MA) is distinguished; the meiosis arrest means that the testis of the patient does not have haploid sperms, and the testis of the NOA patient passing through the meiosis possibly has the formation of the haploid sperms, so that the microscopic sperm obtaining outcome from the testis can be indirectly forecast.

Description

technical field [0001] The invention relates to the technical field of azoospermia detection, in particular to the application of seminal plasma BOLL and a kit for diagnosing azoospermia meiosis block. Background technique [0002] According to World Health Organization estimates, male infertility has become a worldwide reproductive health problem, and there are nearly 80 million infertile couples, about 50% of which are caused by male factors. Azoospermia is a serious type of male infertility, divided into obstructive azoospermia and non-obstructive azoospermia (non-obstructive azoospermia, NOA), of which NOA patients account for about 70%. According to the pathological classification, NOA can be divided into Sertoli cell-only syndrome, spermatogenic block and hypospermatogenic function. At present, the pathological diagnosis of NOA mainly relies on testicular biopsy, which uses puncture to puncture the testicular tissue, then stains the obtained tissue with HE, and observ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6883C12Q1/6851C12Q1/6848
CPCC12Q1/6848C12Q1/6851C12Q1/6883C12Q2600/158C12Q2531/113C12Q2545/101C12Q2549/119
Inventor 李红钢戴豫宛桂耀庭
Owner HUAZHONG UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap