Asialoglycoprotein receptor 1 (ASGR1) mutant gene and application thereof to preparation of mammal liver injury sensitive model
A mutated gene, mammalian technology, applied in the field of genetic engineering, can solve the problems of restricted development and low survival rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1, the preparation of ASGR1 gene knockout piglet
[0040] According to the pig (Sus scrofa) asialoglycoprotein receptor 1 (asialoglycoprotein receptor, ASGR1) gene sequence (Gene ID: NC_010454.4), using single-stranded guide RNA (single guide RNA, sgRNA) online design website (http: / / crispr.mit.edu / ) in its 6th exon ( figure 1 ) designed and synthesized sgRNA (sgRNA:agcagtttgtgtccgacctgcgg, SEQ ID NO:1) that specifically recognizes the target sequence DNA. After the synthesized sgRNA oligonucleotides were annealed (94°C, 10min; 37°C, 10min), they were ligated into the PX330 expression vector recovered by digestion with BbsI to construct the sgRNA expression vector ( figure 2 ). After the constructed expression vector was sequenced to verify that the connection was correct, the plasmid was extracted for cell transfection.
[0041] The validated sgRNA expression vector and Enhanced Green Fluorescent Protein (EGFP) plasmid were co-electrotransfected into Ba...
Embodiment 2
[0050] Example 2, Sensitivity of ASGR1 gene knockout piglets to liver injury
[0051] The obtained ASGR1 knockout pigs were induced by two ways of liver injury.
[0052] 1. Experimental animals
[0053] Experimental group: Offspring of ASGR1 knockout pigs (individuals produced by breeding ASGR1 knockout pigs with WT sows).
[0054] Control group: wild-type pigs (wide type, WT) without gene editing were used as controls.
[0055] The animals in the two groups were all 6 months old, gender, feeding and environment were the same.
[0056] 2. Test method:
[0057] Liver injury induction method: (1) feed pigs with 50% alcohol as a drinking water substitute for 2 months to simulate alcoholic liver injury caused by human drinking; (2) intraperitoneal injection of carbon tetrachloride for 15 days to simulate human drug-induced liver injury liver damage.
[0058] Blood test for liver injury: blood was collected before induction, and then blood biochemical indicators were tested, i...
Embodiment 3
[0069] Example 3, ASGR1 knockout piglets can be passed down normally.
[0070] Taking ASGR1 knockout pigs as an example, 6 primary individuals were obtained through gene editing. Taking ASGR1 knockout pigs as an example, we obtained 6 primary individuals through gene editing. Select ASGR1 No. 332 and No. 334 in the original generation - / - Pigs were mated with wild-type sows, and 10 F1 ASGR1 pigs were obtained + / - pigs, to establish the pedigree of ASGR1 knockout pigs ( Figure 5 ), which has now been bred to the third generation. It shows that the present invention can prepare a population of gene-edited animals with normal breeding and stable inheritance by editing the ASGR1 gene sequence.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


