Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Asialoglycoprotein receptor 1 (ASGR1) mutant gene and application thereof to preparation of mammal liver injury sensitive model

A mutated gene, mammalian technology, applied in the field of genetic engineering, can solve the problems of restricted development and low survival rate

Pending Publication Date: 2020-09-25
成都中科奥格生物科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the key to gene editing technology is the need to screen suitable candidate genes and editing sites, and the low survival rate of gene-edited animals, especially gene-edited animals in disease models, limits its development.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Asialoglycoprotein receptor 1 (ASGR1) mutant gene and application thereof to preparation of mammal liver injury sensitive model
  • Asialoglycoprotein receptor 1 (ASGR1) mutant gene and application thereof to preparation of mammal liver injury sensitive model
  • Asialoglycoprotein receptor 1 (ASGR1) mutant gene and application thereof to preparation of mammal liver injury sensitive model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1, the preparation of ASGR1 gene knockout piglet

[0040] According to the pig (Sus scrofa) asialoglycoprotein receptor 1 (asialoglycoprotein receptor, ASGR1) gene sequence (Gene ID: NC_010454.4), using single-stranded guide RNA (single guide RNA, sgRNA) online design website (http: / / crispr.mit.edu / ) in its 6th exon ( figure 1 ) designed and synthesized sgRNA (sgRNA:agcagtttgtgtccgacctgcgg, SEQ ID NO:1) that specifically recognizes the target sequence DNA. After the synthesized sgRNA oligonucleotides were annealed (94°C, 10min; 37°C, 10min), they were ligated into the PX330 expression vector recovered by digestion with BbsI to construct the sgRNA expression vector ( figure 2 ). After the constructed expression vector was sequenced to verify that the connection was correct, the plasmid was extracted for cell transfection.

[0041] The validated sgRNA expression vector and Enhanced Green Fluorescent Protein (EGFP) plasmid were co-electrotransfected into Ba...

Embodiment 2

[0050] Example 2, Sensitivity of ASGR1 gene knockout piglets to liver injury

[0051] The obtained ASGR1 knockout pigs were induced by two ways of liver injury.

[0052] 1. Experimental animals

[0053] Experimental group: Offspring of ASGR1 knockout pigs (individuals produced by breeding ASGR1 knockout pigs with WT sows).

[0054] Control group: wild-type pigs (wide type, WT) without gene editing were used as controls.

[0055] The animals in the two groups were all 6 months old, gender, feeding and environment were the same.

[0056] 2. Test method:

[0057] Liver injury induction method: (1) feed pigs with 50% alcohol as a drinking water substitute for 2 months to simulate alcoholic liver injury caused by human drinking; (2) intraperitoneal injection of carbon tetrachloride for 15 days to simulate human drug-induced liver injury liver damage.

[0058] Blood test for liver injury: blood was collected before induction, and then blood biochemical indicators were tested, i...

Embodiment 3

[0069] Example 3, ASGR1 knockout piglets can be passed down normally.

[0070] Taking ASGR1 knockout pigs as an example, 6 primary individuals were obtained through gene editing. Taking ASGR1 knockout pigs as an example, we obtained 6 primary individuals through gene editing. Select ASGR1 No. 332 and No. 334 in the original generation - / - Pigs were mated with wild-type sows, and 10 F1 ASGR1 pigs were obtained + / - pigs, to establish the pedigree of ASGR1 knockout pigs ( Figure 5 ), which has now been bred to the third generation. It shows that the present invention can prepare a population of gene-edited animals with normal breeding and stable inheritance by editing the ASGR1 gene sequence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The application belongs to the technical field of genetic engineering, and discloses application of a genetic engineering editing site and obtained asialoglycoprotein receptor 1 (ASGR1) mutant gene topreparation of a mammal liver injury sensitive model. By performing gene editing on a suitable editing site in an ASGR1 gene sequence, an animal model steady to passage and liable to induce into liver injuries is obtained, and a steady breeding population is established. The invention establishes a method for obtaining a genetic engineering non-human mammal model population steady to passage andliable to induce into liver injuries, and meets all experiment needs.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an ASGR1 mutant gene and its application in preparing a sensitive model of mammalian liver injury. Background technique [0002] Animal disease models refer to animals with human disease simulations established in various medical scientific researches. It is mainly used in the research of experimental physiology, experimental pathology and experimental therapeutics (including new drug screening). The development of human diseases is very complicated. Using humans as experimental objects to deeply explore the mechanism of disease occurrence and promote the development of medicine has come slowly. The accumulated clinical experience is not only limited in time and space, but many experiments are carried out on experimental animals. There are also ethical and methodological constraints. With the help of indirect research on animal models, factors that are i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N15/87C12N15/90A01K67/027
CPCC07K14/7056C12N15/113C12N15/8778C12N15/907A01K67/0276C12N2310/20A01K2207/15A01K2217/075A01K2227/108A01K2267/03
Inventor 潘登科邢向阳
Owner 成都中科奥格生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com