Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of primer and method for detecting Alternaria brassicae by lamp

A technology of Alternaria and Brassica, applied in the field of molecular biology, can solve problems such as undiscovered, and achieve the effects of simple operation, convenient identification and simple equipment

Active Publication Date: 2022-06-24
JIANGSU ACAD OF AGRI SCI +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the reports of LAMP technology are mostly found in health safety detection, disease diagnosis and environmental safety detection, etc., but in the detection of plant pathogenic fungi, the application of LAMP technology needs to be further expanded, and no LAMP method has been found to detect Alternaria brassicae to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of primer and method for detecting Alternaria brassicae by lamp
  • A kind of primer and method for detecting Alternaria brassicae by lamp
  • A kind of primer and method for detecting Alternaria brassicae by lamp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028](1)引物设计:以芸薹生链格孢的序列(TGACAGACACTCCAACGGACCCTATGGATAGCCAGACGGATATTGACAATATTCAAAACATACCAGCAAACAGCGACGCTAGCAATGGAAGCCCACGCCCGCAAGCTACAAAGTCAGACAGCGAACATATGGACGAGTGGCTTGGAGATGTATTAGTCGAAGTTAATAATGACTACGGAATCACCTGCGAAATCAAAGTCGAAGAATATCTAGACATCACAACCACAAGATCTGATGATGAAAATTGCTGGCTGCATTCCAATAGTATCGACCTCGCCCTCGCTCTATTGACACAGCGTGAGGGGCGCAAGGACGTTTGTACACTTACAATTCAACATGGTATCGATTTATTCCGGGTAGGCTGGGGAACAAGCAAGATGGAGGATTTGCTCAATGATCCTTTTATTGGACCTGCACTGAAGGATGTAAAGAGGCGCTTCATTGTGGTTCCTGTAAATGATGGACCGATACAGTAAGTGTTCCTTTACGAACTGTAGGTGAGACATGTACTGACTTTGTATACCAACATCTAGCTTCGTAAGGGAACAGGCAGACAAAGACGAGAAAACCCTGGCAAAACAGAAAATCGCCAAGATTTCTGAGAAAGAAAGTGCTAAGGAGGTAAAAAAAAGCGCAGATGTTATCAAACAAAGAACCTACAGCACCCACTGGGGGCTCTTAGTGATCGACAAGGAAAAGCGGAAAGCACGCTGGATAGACAGCTCTCTGGCCCTCACCAACAATAGGAAATATCCTGATAGAAAGCGAATCGTTACCATGTCACAAGCCGCAATAGCCGCCGGAAAGATTCTCTGCGCCATCGAACAGGTCCTTGGTTCCGCGCGAGGAACATTCGACGCGAAGACCGCCAAATACGTTCCACAACAGATAGATGACAACAGATTCAAAGATGATCCAGGAGCATCCTGTGGACCATACATGTTCGCTTTTCTCCAGTATTTGTACAAGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a method for detecting Alternaria brassicae by LAMP, belonging to the technical field of molecular biology. A method for detecting Alternaria brassicae by LAMP disclosed in the invention comprises the steps of extracting Alternaria brassicae genomic DNA; using the genomic DNA as a template, and using primers to perform LAMP amplification; LAMP product detection: after the reaction, Directly observe the color change of the reaction solution; or detect it by agarose gel electrophoresis. A primer and a method for detecting Alternaria brassicae disclosed by the invention have strong specificity and high sensitivity; the equipment used is simple, easy to operate and easy to identify; and it can realize rapid and efficient amplification.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a primer and a method for LAMP detection of Alternaria brassicae. Background technique [0002] Alternaria brassicicola is the pathogen that causes fungal black spot on cabbage (hereinafter referred to as black spot). Black spot disease can occur in the whole growth period of cabbage, and can infect the leaves, leaf bulbs, stems and siliques of cabbage and other tissues, and endanger the production of cabbage vegetables. [0003] Although there have been reports on the molecular detection of Alternaria brassicae, these methods are mainly based on traditional PCR and fluorescence quantitative PCR detection, which are highly dependent on special equipment and cannot meet the needs of rapid and convenient detection. Loop-mediated isothermal amplification (LAMP) is a new molecular biology method, which uses 4-6 primers to achieve rapid amplification of target fragments und...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6844C12Q1/04C12N15/11
CPCC12Q1/6895C12Q1/6844C12Q2531/119C12Q2565/125
Inventor 余方伟王神云张伟李建斌于利
Owner JIANGSU ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More