Antibody for preventing or treating cancer
An antibody, cancer technology, applied in the direction of antibodies, applications, anti-tumor drugs, etc., can solve the problems of Claudin18.2 unable to play normal functions and the destruction of tight junctions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1 Construction of HEK293 cells expressing Claudin18.1 and Claudin18.2 antigens
[0066] The pcDNA3.1 vector encoding human Claudin18.1 and Claudin18.2 antigen genes (purchased from Invitrogen) was transfected into HEK293 cells (purchased from ATCC), and 200 μg / mL geneticin was used as the selection pressure to obtain stable expression of Claudin18.1 and Claudin18.2 antigen HEK293 cells. The Claudin18.2 antibody IMAB362 of Ganymed Company was used as a positive antibody (self-made, CHO-S cell (Invitrogen) transient expression and one-step affinity chromatography purification, the specific method refers to Examples 2 and 3, that is, BY0-0 is positive Antibody), HEK293 cells stably expressing human Claudin18.1 and Claudin18.2 antigens were screened by FACS method.
Embodiment 2
[0067] Example 2 Construction of Candidate Antibody BY4-8 Expression Vector
[0068] The HindIII restriction site ( AAGCTT), KoZAK sequence ( GCCGCCACC ), ATG, signal peptide gene GAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and antibody heavy chain coding gene (including heavy chain variable region coding gene SEQ ID NO: 18 and constant region IgG1 coding gene SEQ ID NO: 20), termination code TAA and EcoRI coding gene GAATCC Sequential fusion in series, and the use of chemical synthesis to obtain gene fragments. Through the EcoRI and HindIII sites, the above fragment was inserted into the eukaryotic expression plasmid pCDNA 3.4(+) (purchased from Invitrogen) and verified by sequencing to obtain the expression plasmid pCDNA3.4(+)-BY4-7 of the antibody heavy chain.
[0069] The HindIII restriction site ( AAGCTT ), KoZAK sequence ( GCCGCCACC ), ATG, signal peptide gene GAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and antibody light chain coding ...
Embodiment 3
[0073] Example 3 Expression and purification of anti-Claudin18.2 antibody
[0074] Using the DNA constructs described in Example 2, they were respectively transiently transfected into CHO-S cells (purchased from Invitrogen) to express the target antibody. According to the CHO-S cell operation manual provided by the manufacturer (Freedom TM CHO-S TM KitUSER GUIDE), adjust the cell density to 1x10 the day before plasmid transfection 6 individual / ml. On the day of plasmid transfection, mix with the transfection reagent and add to EXPICHO EXPRESSION MEDIUM cell culture medium (purchased from Invitrogen Company), 37°C, 8% CO2 continued to culture until the 8th day, collected the cell liquid, and removed the cells by centrifugation, 0.2 After μm filtration, Protein A was purified by affinity chromatography, the pH of the collected samples was adjusted to 5.5, and stored at 2-8°C. The purified antibody was detected by SDS-PAGE and SEC-HPLC, and the purity was above 95%.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com