SNP molecular marker related to cotton flower basal spot traits and application thereof

A molecular marker, cotton technology, applied in the field of plant molecular biology, to achieve broad application prospects and the effect of automatic detection

Active Publication Date: 2021-02-09
SHIHEZI UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular markers related to cotton flower spots have not been reported at present. The purpose of the present invention is to find a new SNP molecular marker that is closely linked or co-segregated with cotton flower spots traits, providing a basis for the molecular detection of cotton flower spots traits. Convenience, and at the same time, it is helpful for the selection of cotton varieties with flower base spot traits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker related to cotton flower basal spot traits and application thereof
  • SNP molecular marker related to cotton flower basal spot traits and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] 1. Experimental materials and group construction

[0019] Cotton with flower basal spot material is crossed with conventional non-flower basal spot cultivars to obtain F1, and F1 is self-crossed to obtain F2, which is used as a genetic population for research. In order to control the systematic error of the field experiment, all materials were planted in the same field to ensure consistent environmental conditions.

[0020] 2. Investigation on the basal spots of cotton flowers

[0021] The investigation of the basal spot traits of each individual plant in the F2 population is in line with Mendel's law of segregation. Controlled by dominant genes.

[0022] 3. BSR high-throughput sequencing

[0023] Based on the above genetic analysis results, samples were taken from individual plants with and without basal spots in the F2 population, and a mixed pool of progenies with and without basal spots was constructed for BSR high-throughput sequencing. A total of 21854 polymor...

Embodiment 2

[0039] The present embodiment provides a method for detecting cotton flower basal spots using cotton flower basal spot traits related SNP molecular markers, comprising the following steps:

[0040] (1) Utilize the conventional plant tissue DNA extraction method to extract the cotton tissue DNA to be detected;

[0041](2) Using MASSARRAY technology, design specific primers according to the SNP molecular marker, the sequence is as follows:

[0042] Upstream primer: ACGTTGGATGTGAGCCTTCCATATAGAAGC

[0043] Downstream primer: ACGTTGGATGAAACGGAGTTTGGCCAACAC

[0044] Extension primer: TGACATTTTATAAACACACCTA

[0045] (3) Use the cotton tissue DNA as a template, and use the designed specific primers to perform PCR amplification

[0046] Take 1 μL of DNA solution with a concentration of 10ng / μL for PCR amplification. The PCR reaction solution should contain Water, HPLC grade 927.5 μL, 10x PCR Buffer with 15mM MgCl 2 331.25 μL, 25 mM MgCl 2 172.25μL, 53μL of 25mM dNTP Mix, 530μL o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an SNP molecular marker related to cotton flower basal spot traits and application thereof. The SNP molecular marker is provided with a nucleotide sequence consisting of a 10763953rd basic group on a seventh chromosome of cotton and upstream and downstream basic groups of the 10763953rd basic group, and the polymorphism is C or A. The SNP molecular marker is directly expressed in the form of DNA, can be detected in various development stages and different tissues and organs of the cotton, is not limited by environment and seasons, and is not influenced by the problemsof expression or not and the like. By extracting cotton tissue DNA and performing PCR amplification by using specific primers, a material with genotype A is a material with flower basal spots, and a material with genotype C is a material without flower basal spots, so that the rapid, large-scale and automatic detection of a to-be-detected sample is achieved.

Description

technical field [0001] The invention belongs to the technical field of plant molecular biology, in particular to the technical field of molecular detection of cotton flower basal spot traits, in particular to a SNP molecular marker related to cotton flower basal spot traits and an application thereof. Background technique [0002] Cotton is an important economic crop in my country. As the main raw material of the textile industry, its yield, quality and other traits have attracted the attention of breeders. Nowadays, with the continuous advancement of sequencing technology, the method of molecular marker-assisted selective breeding is new cotton varieties The breeding of molecular markers has provided more and more conveniences, and molecular marker-assisted selection breeding has become more and more popular. How to find a convenient, fast and unaffected molecular marker site has become the primary problem of marker-assisted selection breeding. . [0003] Cotton flower basal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2600/172C12Q2531/113C12Q2521/525C12Q2533/101C12Q2565/627
Inventor薛飞梁倩王学峰邵冬南孙杰杨永林李艳军刘峰张新宇
OwnerSHIHEZI UNIVERSITY