A molecular marker related to the color of the pericarp covered by eggplant sepals and its application
A technology of molecular markers and eggplants, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, biochemical equipment and methods, etc., can solve the problem of little research on genes related to calyx fruit color regulation, and achieve easy batch operation , saving manpower, saving land and labor costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Determination of Molecular Markers
[0036] 1.1 experimental materials
[0037] In 2018, in 2018, Wuqing Innovation Base in Tianjin Agricultural Sciences, the Spring is the experiment seed y5 of the genital repository of the Tianjin Agricultural Sciences Vegetable Research Institute, Y73 is a parent, formulated a combination and harvest F1 hybrid. In the spring of 2019, F1 was planted and passed from the self-cultivation, and the parent Y5, Y73 and F2 generation seeds were grown in the fall of 2019. On June 15th, seedling seedlings were planted on July 16, which was planted in the joint greenhouse. The parental materials were cultivated, and 185 F2 groups were planted, the line distance of 60 cm × 70cm, black film coverage, conventional cultivation management. The planting environment is a joint greenhouse, which is in advance, and the concentration is sprayed, and the concentration is controlled, so that the light shielding rate reaches 83% (referring to the bran...
Embodiment 2
[0057] Embodiment 2 Determination of specific primers of molecular markers
[0058] 2.1 100bp base information before and after variation base
[0059] > SNP1 → CHR10 → 2618543 → 2618743
[0060] AAGCAATGGATATGGGAAGTGCTGGCAAGGCATGTCGACACACAGCTAACAATATAAGTGTGCACCCTAATCCAGATATAATAGCGAGATAACAAGCAT [A / G] AACAGTCATCAAATCATACATTGCAGCTCTCCCCACCAACACACTATAGAAAACAAAATCTCCTAAACCAAGCTTTATCCCCCTCCCTCTCTCCTCCTCT
[0061] 2.2 Design KASP primers according to variant base information
[0062] like Figure 4 The KASP primer includes an upstream primer 1, an upstream primer 2, and a downstream primer.
[0063] Upstream primer 1:
[0064] Gaaggtgccaagttcatgctgctgcaatgttgattgatgactgttt.
[0065] Upstream primers 2:
[0066] Gaaggtcgggg atcaacgattgctgcaatgttgattgatgactgttc.
[0067] Downstream primers: caatgatatgggaagtgctggc.
[0068] The sequence of the upstream primer 1 is shown in SEQ ID NO: 2, and the sequence of the upstream primer 2 is shown in SEQ ID NO: 3, and the sequence of the downstream ...
Embodiment 3
[0072] Example 3 Verification of Molecular Markers
[0073] 3.1 Test Materials
[0074] In the autumn of 2020 and the 2021 spring season breeding materials, including two types of purple and duty under green eggplants, a total of 91 experimental materials.
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com