Molecular marker related to pericarp color under eggplant sepal coverage and application
A molecular marker, eggplant technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., which can solve the problem of little research on the genes related to the regulation of fruit color under the calyx.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Determination of Example 1 Molecular Markers
[0036] 1.1 Experimental materials
[0037] The experiment was carried out at the Wuqing Innovation Base of Tianjin Academy of Agricultural Sciences in 2018. In the spring, the experimental seeds Y5 from the Germplasm Resource Bank of the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences were used as the female parent, and Y73 was used as the male parent. F1 hybrids were prepared and harvested. In the spring of 2019, the F1 generation was planted and self-crossed to obtain the F2 generation seeds. In the autumn of 2019, the parents Y5, Y73 and F2 generation seeds were planted at the same time. Seedlings were sown on June 15, and they were planted in multi-span greenhouses on July 16. Plant 20 plants with parental materials and 185 plants with F2 populations. The row spacing between plants is 60cm×70cm, covered with black plastic film, and conventional cultivation management. The planting environment i...
Embodiment 2
[0057] The determination of the specific primer of embodiment 2 molecular marker
[0058] 2.1 100bp base information before and after the mutated base
[0059] >SNP1→chr10→2618543→2618743
[0060] AAGCAATGGATATGGGAAGTGCTGGCAAGGCATGTCGACACACAGCTAACAATAATAAGTGTGCACCCTAATCCAGATATAATAGCGAGATAACAAGCAT[A / G]AACAGTCATCAAAATCATACATTGCAGCTCTCCCCACCAACACACTATAGAAAACAAAATCTCCTAAACCAAGCTTTATCCCCCTCCCTCTCTCCTCCTCT
[0061] 2.2 Design KASP primers according to the information of mutated bases
[0062] Such as Figure 4 , the KASP primers include upstream primer 1, upstream primer 2 and downstream primer.
[0063] Upstream primer 1:
[0064] GAAGGTGACCAAGTTCATGCTGCTGCAATGTATGATTTGATGACTGTTT.
[0065] Upstream primer 2:
[0066] GAAGGTCGGAGTCAACGGATTGCTGCAATGTATGATTTGATGACTGTTC.
[0067] Downstream primer: CAATGGATATGGGAAGTGCTGGC.
[0068] The sequence of the upstream primer 1 is shown in SEQ ID NO:2, the sequence of the upstream primer 2 is shown in SEQ ID NO:3, and the sequence of th...
Embodiment 3
[0072] Example 3 Verification of Molecular Markers
[0073] 3.1 Test material
[0074] The breeding materials in the fall of 2020 and the spring of 2021 include two types of eggplants, purple under the calyx and green eggplant under the calyx, with a total of 91 experimental materials.
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com