Construction of attenuated African swine fever gene deletion strain and its application as a vaccine

A technology of African swine fever virus and gene deletion, applied in vaccines, applications, genetic engineering, etc., can solve the problems of different effects, insufficient pathogenicity, residues, etc., and achieve good safety performance

Active Publication Date: 2022-02-18
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the virulence gene knockout vaccine of classical swine fever virus still has the following problems: ① Different strains have different effects of deleting the same gene, and if the deletion is not sufficient, there will be residual virulence and pathogenicity, and multiple gene deletions cause The low titer of the virus will also reduce the risk of immunogenicity or protective effect of the attenuated strain; ②Whether the knockout virulence gene reduces virus transmission and detoxification is an important indicator of biosafety, and it is best to obtain an immune clearance vaccine Candidate strains to reduce the risk of detoxification and detoxification; ③Although the whole genome sequencing of African swine fever has been completed, there are more than 160 regulatory genes and structural genes that make up the African swine fever virus. Although the functions of all genes are studied It is a huge project, but a comprehensive study of the function of each regulatory gene and structural gene is crucial for its pathogenic mechanism and vaccine development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of attenuated African swine fever gene deletion strain and its application as a vaccine
  • Construction of attenuated African swine fever gene deletion strain and its application as a vaccine
  • Construction of attenuated African swine fever gene deletion strain and its application as a vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1 Construction and purification identification of recombinant virus Δ181 / UK

[0073] 1. CRISPR / Cas9 vector construction

[0074] (1) Optimization of the pX330 vector: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the nuclei at both ends of the Cas9 enzyme were removed by the ClonExpress II one-step cloning method Localization signal (NLS), named pX330ΔN.

[0075] (2) The MGF360-18R gene, DP71L gene and DP96R gene are adjacent genes. Targeting gRNAs targeting DP71L and DP96R genes were designed. The oligonucleotide names and sequences are: 181 / UK-gRNA-L: GCTCCTCCACGCTCGCGATCCGG( shown in SEQ ID NO.8); 181 / UK-gRNA-R: TTACAGGAAGAATAATGG GGAGG (shown in SEQ ID NO.9).

[0076] (3) Refer to the cloning method recommended by the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;...

Embodiment 2

[0085] The mensuration of embodiment 2 virus titer

[0086] The titer of African swine fever virus is represented by half hematosorption (50% haemadsorption, HAD50). For the specific operation of HAD50 experiment, see literature (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG,Velazquez-Salinas L,Zhu J,GladueDP.Development of a highly effective Afri can swine fever virus vaccine by deletion of the I177Lgene results in sterile immunity aga inst the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) , while adjusting it appropriately: in a 96-well plate according to approximately 1x10 5 Cells per well were inoculated with primary PAM cells, and the recombinant virus to be tested was serially diluted 10 times, a total of 7 dilutions, each dilution was 8 wells, and the diluted virus was added to the PAM of a 96-well plate at 100 μL / well, and then added Red blood cells, a total of three replicates. Virus infection can be judged according to the...

Embodiment 3

[0087] Example 3 Toxicity Evaluation of Gene Deletion Strain Δ181 / UK

[0088] In order to detect the virulence of the gene deletion strain Δ181 / UK, 10 4 HAD 50 The toxicity of the dose was evaluated by intramuscular injection in pigs.

[0089] In this experiment, 13 African swine fever antigen antibody-negative healthy Landrace piglets were divided into 3 groups, including 5 piglets in each of the parental strain A SFV CN / GS / 2018 isolate and the gene deletion strain Δ181 / UK group. The 3 experimental pigs were cohabitation controls of the Δ181 / UK inoculated group. After inoculation, body temperature changes were measured every day, and peripheral blood and saliva were collected. Refer to literature (KingDP, Reid SM, Hutchings GH, Grierson SS, Wilkinson PJ, Dixon LK, Bastos AD, DrewTW.20 03.Development of a TaqMan PCR assay with internal amplification control for the detecti on of African swine fever virus.J Virol Methods 107:53-61), measure the ASFV virus content in the blood...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering, and specifically relates to a gene-deleted attenuated African swine fever virus strain that can be used as a vaccine and a construction method thereof. The virus strain is the gene of a parent African swine fever virus ASFV CN / GS / 2018 isolate Deletion of attenuated strains. The present invention discovered that the DP71L gene is a new target gene that weakens the pathogenicity of pigs, and found that the function of the protein encoded by the MGF360‑18R gene, DP71L gene and DP96R gene was jointly lost, which reduced the toxicity of the parental strain and obtained a strain Highly safe attenuated African swine fever candidate vaccine strain; described attenuated African swine fever candidate vaccine strain high dose (10 4 HAD 50 ) after immunizing pigs, the pigs are completely attenuated, the immunized pigs are healthy, do not get sick, and the nucleic acid of the cohabiting pigs with the immunized pigs is also negative, does not spread horizontally, and has good safety; and can be against the strong strain of ASFV CN / GS / 2018 The challenge virus provides 100% immune protection, which can be used as a safe and effective candidate vaccine for the prevention and control of African swine fever, and has great social value.

Description

[0001] This application claims the priority of the previous application with the application date of July 10, 2020, the application number CN202010661680.7, and the invention title "Construction of African Swine Fever Gene Deletion Attenuated Strain and Its Application as a Vaccine". The entire content of the earlier application has been embodied in this application. technical field [0002] The invention belongs to the technical field of bioengineering, and in particular relates to the construction of an attenuated African swine fever gene-deleted attenuated strain whose MGF360-18R gene, DP71L gene and DP96R gene-encoded protein function has been lost and its application as a vaccine. Background technique [0003] African swine fever (African swine fever, ASF) is caused by the infection of African swine fever virus (ASFV), and is characterized by fever and hemorrhage in pigs. The fatality rate for domestic pigs is as high as 100%. . The disease first broke out in Kenya in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/34C07K14/01C12N7/01C12N15/85C12N15/90A61K39/12A61P31/20C12R1/93
CPCC07K14/005C12N7/00C12N15/85C12N15/902A61K39/12A61P31/20C12N2710/12022C12N2710/12021C12N2710/12034C12N2710/12052C12N2800/107A61K2039/5254A61K2039/552
Inventor郑海学李攀冯涛齐晓兰刘华南张克山李丹吴盼雪马昭党文刘迎琦石正旺杨波田宏郭建宏刘湘涛
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI