Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application

A technology of African swine fever virus and African swine fever, which is applied in the field of bioengineering, can solve the problems of high cost, many virulence genes knocked out, safety problems, etc., achieve good safety performance, promote the production of interferon, reduce the toxic effect

Inactive Publication Date: 2020-12-11
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the virulence gene knockout vaccine of classical swine fever virus still has the following problems: ① Different strains have different effects of deleting the same gene. Low titer will also reduce the risk of immunogenicity or protective effect of the attenuated virus strain; ② There are many virulence genes knocked out, not only the operation is complicated and the cost is high, but also whether the gene knockout is successful must also be considered. The more genes that are knocked out, the lower the success rate of gene knockout is likely to be. Once the knockout is incomplete, it will cause safety problems; ③Although the whole genome sequencing of African swine fever has been completed, the composition of the African swine fever virus There are as many as 151 regulatory genes and structural genes. A comprehensive study of the function of each regulatory gene and structural gene is crucial to its pathogenic mechanism and vaccine development. It can clarify the gene function, and then drive the transformation and improvement of vaccine seeds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application
  • Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application
  • Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Construction and purification identification of recombinant virus MGF-Δ9L

[0056] 1. CRISPR / Cas9 vector construction

[0057] (1) pX330 vector optimization: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the Cas9 enzyme at both ends was removed by the ClonExpress II one-step cloning method. Nuclear localization signal (NLS), designated pX330ΔN.

[0058] (2) Design targeting gRNAs for ASFV MGF-110-9L gene, its oligonucleotide name and sequence are respectively: MGF1109L-gRNA-LF: CTCCTGTTCCTGGAAAAGATTGG' (shown in SEQ ID NO.3) and MGF1 109L-gRNA -RF: TTAATTGTACAGTTTCCCGGTGG (shown in SEQ ID NO. 4).

[0059](3) Referring to the cloning method recommended by the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9system. NatProtoc. 2013; 8(11): 2281-2308), the The oligonucleotides MGF1109L-gRNA-LF and...

Embodiment 2

[0071] Example 2 ASFV MGF-110-9L immunosuppressive experiment

[0072] HEK293 cells in good condition were digested with trypsin and spread on a 48-well plate, placed at 37°C, 5% CO 2 Cells were cultured in an incubator for 12 hours, and Lipofectamine TM 2000 transfection was performed when the cell density was nearly 70%-80%. 100ng of IFN-β reporter plasmid, 10ng of internal reference TK, and 100ng of MGF-110-9L plasmid ( The ASFV MGF-110-9L gene was inserted into the PCMV plasmid to obtain the PCMV-MGF-110-9L plasmid) and simultaneously transfected into HEK293 cells. After 24 hours of transfection, the successfully transfected cells were retransfected with HT-DNA (1 μg / mL), transfected for 12h. At least three parallel holes were set up in the experiment to ensure the reliability of the experimental results. Add 50 μL of 1×passive lysis buffer to each well to lyse at room temperature for 15-20min, and detect the activity of the dual luciferase reporter gene after sufficien...

Embodiment 3

[0073] The titration of embodiment 3 virus titers

[0074] The titration of African swine fever virus adopts the half hematosorbate amount (50% haemadsorption, HAD 50 ) method to operate. References (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine feve r virus vaccine by deletion of the I177L genes results in sterile immunity against the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) for HAD 50Experimental operation, and make appropriate adjustments: Inoculate primary PBMCs in 96-well cell culture plates (Mason, D.W., W.J.Penhale, and J.D.Sedgwick, 1987: Preparation of lymphocytes subpopulations. In: Klaus, G.G.B. (ed.) Lymphocytes: aPractical Approach, pp.35-54.IRL Press, Oxford.), carry out 10-fold gradient dilution of the sample to be tested, and inoculate 0.02ml in each hole, and the virus infection can be judged according to the rosette formed ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a natural immunosuppressive gene deleted attenuated African swine fever virus strain and application. The invention discovers that ASFV MGF-110-9L has a function of inhibiting generation of interferon, and an ASFV MGF-110-9L gene is deleted in an original African swine fever virus strain, so that the virulence of a parent strain can be reduced, and the attenuated African swine fever virus strain is obtained; and the virulence of the attenuated African swine fever virus strain to pigs is remarkably weakened, so that the safety of the strain is improved. The gene ASFV MGF-110-9L is deleted in the parent strain, so that the toxicity of the parent strain is reduced, and a theoretical basis and a practical reference are provided for successfully preparing an African swine fever vaccine in the future; and researchers can finally prepare a safe and effective African swine fever vaccine candidate strainby simultaneously knocking out the ASFV MGF-110-9L and one or more disclosed virulence genes (such as CD2V, MGF 360-12L, MGF 360-13L, MGF 360-14L, and MGF 360-505R).

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to an attenuated African swine fever virus strain lacking a natural immunosuppressive gene and its application. Background technique [0002] African swine fever (African swine fever, ASF) is caused by the infection of African swine fever virus (ASFV), and is characterized by fever and hemorrhage in pigs. The fatality rate for domestic pigs is as high as 100%. . The disease first broke out in Kenya in 1921 and subsequently became widespread among domestic and wild pigs throughout Africa. It was introduced into Europe in the 1950s, and it took 40 years to eliminate the disease throughout Europe. However, the disease was introduced to Georgia from East Africa again in 2007, and then spread widely in Eastern Europe, and in 2017, it was introduced to Irkutsk in the Russian Far East. In early August 2019, researcher Hu Rongliang took the lead in reporting the first ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/34C12N7/01A61K39/12A61P31/20
CPCA61K39/12A61K2039/5254A61K2039/552A61P31/20C07K14/005C12N7/00C12N2710/12022C12N2710/12034
Inventor郑海学李丹李攀齐晓兰张克山茹毅杨吉飞田宏杨帆申超超刘志杰吴森党文殷宏刘湘涛
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI