Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application

A technology of African swine fever virus and African swine fever, which is applied in the field of bioengineering, can solve the problems of high cost, many virulence genes knocked out, safety problems, etc., achieve good safety performance, promote the production of interferon, reduce the toxic effect

Inactive Publication Date: 2020-12-11
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the virulence gene knockout vaccine of classical swine fever virus still has the following problems: ① Different strains have different effects of deleting the same gene. Low titer will also reduce the risk of immunogenicity or protective effect of the attenuated virus strain; ② There are many virulence genes knocked out, not only the operation is complicated and the cost is high, but also whether the gene knockout is successful must also be considered. The more genes that are knocked out, the lower the success

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application
  • Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application
  • Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0055] Example 1 Construction and purification identification of recombinant viruses MGF-Δ9L

[0056] 1. CRISPR / CAS9 vector construction

[0057] (1) PX330 vector optimization: Since the African swine fever virus is replicated in the cytoplasmic virus factory, the PX330 is first optimized when constructing the P CRISPR / CAS9 vector; the CLONEXPRESS II is combined to remove its Ca S9 enzyme. Nuclear positioning signal (NLS), named PX330Δn.

[0058] (2) Designed to target GRNAs for ASFV MGF-110-9L genes, its oligonucleotide names and sequences are: MGF1109L-GRNA-LF: CTCCTGTTCCTGGAAAAAGATTGGG '(SEQ ID NO.3) and MGF1 109L-GRNA -Rf: tTaattgtacagttcccggggTGG (shown in SEQ ID NO.4).

[0059](3) Referring to the literature (RAN FA, HSU PD, Wright Da, ZHANG F.GenomeEngineering Using The Crispr-Cas9System.natProtoc.2013; 8 (11): 2281-2308) Recommended cloning method, Oligonucleotides MGF1109L-GRNA-LF and MGF1109L-GRNA-RF were inserted into the PX330-Δn vector, respectively, and the plasm...

Example Embodiment

[0071] Example 2 ASFV MGF-110-9L immunosuppressive experiment

[0072] The HEK293 cells with good state were storeded in 48-well plates with trigase, put them at 37 ° C, 5% CO 2 Cellular incubator culture culture medium 12 h, to be cell density to be induced by nearly 70% to 80% to transfection, 100 ng IFN-β report plasmid, 10 ng of internal parametric TK, and 100 ng of MGF-110-9L plasmid (will ASFV MGF-110-9L gene is inserted into the PCMV plasmid, and PCMV-MGF-110-9L plasmids were subjected to Synchronous transfection into HEK293 cells, and the transfected cells were again transfected with HT-DNA again (1μg). / ml), transfected 12h. At least three parallel holes are set in the experiment to ensure the reliability of the experimental results. 50 μl of 1 × Passive Lysis buffer was added to 15-20 min, and the luciferase reporter gene activity was detected after sufficient fraction. Such as Figure 5 As shown, ASFV MGF-110-9L can significantly inhibit HT-DNA-induced IFN-β activity an...

Example Embodiment

[0073] Example 3 Titration of viral titers

[0074] The titration of the African swine fever virus adsorbed (50% haemadsorption, HAD) 50 The method is operated. Referring to the literature (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, GladueDP.Development of a highlyeffective African swine feve r virus vaccine by deletion of the I177L GeneResults in sterile imminity against the current epidemic eurasiStrain.jvirol.2020.pii: jvi.02017-19) Perform HAD 50Test procedure, and to make appropriate adjustments: In 96-well cell culture plate seeded primary PBMC (Mason, DW, WJPenhale, and JDSedgw ick, 1987: Preparation of lymphocytes subpopulations.In:Klaus,GGB(ed.)Lymphocytes: aPractical Approach, pp.35-54.IRL Press, Oxford.), the sample to be tested for 10-fold dilutions of each seeded 0.02ml, viral infection can be determined according to the erythrocyte rosette formation around the infected cell aggregation was observed 7 days, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a natural immunosuppressive gene deleted attenuated African swine fever virus strain and application. The invention discovers that ASFV MGF-110-9L has a function of inhibiting generation of interferon, and an ASFV MGF-110-9L gene is deleted in an original African swine fever virus strain, so that the virulence of a parent strain can be reduced, and the attenuated African swine fever virus strain is obtained; and the virulence of the attenuated African swine fever virus strain to pigs is remarkably weakened, so that the safety of the strain is improved. The gene ASFV MGF-110-9L is deleted in the parent strain, so that the toxicity of the parent strain is reduced, and a theoretical basis and a practical reference are provided for successfully preparing an African swine fever vaccine in the future; and researchers can finally prepare a safe and effective African swine fever vaccine candidate strainby simultaneously knocking out the ASFV MGF-110-9L and one or more disclosed virulence genes (such as CD2V, MGF 360-12L, MGF 360-13L, MGF 360-14L, and MGF 360-505R).

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to an attenuated African swine fever virus strain lacking a natural immunosuppressive gene and its application. Background technique [0002] African swine fever (African swine fever, ASF) is caused by the infection of African swine fever virus (ASFV), and is characterized by fever and hemorrhage in pigs. The fatality rate for domestic pigs is as high as 100%. . The disease first broke out in Kenya in 1921 and subsequently became widespread among domestic and wild pigs throughout Africa. It was introduced into Europe in the 1950s, and it took 40 years to eliminate the disease throughout Europe. However, the disease was introduced to Georgia from East Africa again in 2007, and then spread widely in Eastern Europe, and in 2017, it was introduced to Irkutsk in the Russian Far East. In early August 2019, researcher Hu Rongliang took the lead in reporting the first ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/34C12N7/01A61K39/12A61P31/20
CPCA61K39/12A61K2039/5254A61K2039/552A61P31/20C07K14/005C12N7/00C12N2710/12022C12N2710/12034
Inventor 郑海学李丹李攀齐晓兰张克山茹毅杨吉飞田宏杨帆申超超刘志杰吴森党文殷宏刘湘涛
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap