Gene-deleted attenuated African swine fever virus strain and application thereof
An African swine fever virus, African swine fever technology, which is applied in the field of bioengineering and can solve the problems of reduced immunogenicity or protective effect of attenuated strains, complicated operation, and large engineering.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Construction and purification identification of embodiment 1 recombinant virus MGF-Δ7R
[0053] 1. CRISPR / Cas9 vector construction
[0054] (1) pX330 vector optimization: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the nuclei at both ends of the Cas9 enzyme were removed by ClonExpress II one-step cloning method Localization signal (NLS), named pX330ΔN.
[0055] (2) Design targeting gRNAs for ASFV MGF-505-7R gene, its oligonucleotide name and sequence are respectively: MGF5057R-gRNA-LF:AAAATCACTTGGAAGGAAGAAGG (shown in SEQ ID NO.3) and MGF5057R-gRNA-RF : CATGGCATACTCCAAAGCATAGG (shown in SEQ ID NO.4).
[0056] (3) Refer to the cloning method recommended by the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9 system. NatProtoc.2013; 8(11):2281-2308), The oligonucleotides MGF5057R-gRNA-LF and MGF5057R-gR...
Embodiment 2
[0068] Example 2 ASFV MGF-505-7R immunosuppressive experiment
[0069] HEK293 cells in good condition were digested with trypsin and spread on a 48-well plate, placed at 37°C, 5% CO 2 Cells were cultured in an incubator for 12 hours, and Lipofectamine TM 2000 transfection was performed when the cell density was nearly 70%-80%. 100ng of IFN-β reporter plasmid, 10ng of internal reference plasmid TK, and 100ng of MGF-505-7R plasmid ( The ASFV MGF-505-7R gene was inserted into the pCMV plasmid to obtain the pCMV-MGF-505-7R plasmid) and the cGAS+MITA plasmid were synchronously transfected into HEK293 cells for 12 hours. Three parallel holes were set up in the experiment to ensure the reliability of the experimental results. Add 50 μL of 1×passive lysis buffer to each well to lyse at room temperature for 15-20min, and detect the activity of the dual luciferase reporter gene after sufficient lysis. The result is as Figure 5 As shown, among them, the abscissa is different plasmids...
Embodiment 3
[0070] The titration of embodiment 3 virus titers
[0071] The titration of African swine fever virus adopts the half hematosorbate amount (50% haemadsorption, HAD 50 ) method to operate. References (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine fever virus vaccine by deletion of the I177L Generesults in sterile immunity against the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) carry out HAD 50 Experimental operation, and make appropriate adjustments: Inoculate primary PBMCs in 96-well cell culture plates (Mason, D.W., W.J. Penhale, and J.D. Sedgwick, 1987: Preparation of lymphocytes subpopulations. In: Klaus, G.G.B. (ed.) Lymphocytes: a Practical Approach , pp.35-54.IRL Press, Oxford.), the sample to be tested was diluted 10 times, and 0.02ml was inoculated in each well. The virus infection can be judged by the rosette formed by the aggregation ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com