Attenuated African swine fever viral strain with deficient natural immunosuppression genes and application

An African swine fever virus and gene deletion technology, applied in the field of bioengineering, can solve the problems of complex operation, low virus titer, and many knockout virulence genes.

Active Publication Date: 2021-06-04
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the virulence gene knockout vaccine of classical swine fever virus still has the following problems: ① Different strains have different effects of deleting the same gene. Low titer will also reduce the risk of immunogenicity or protective effect of the attenuated virus strain; ② There are many virulence genes knocked out, not only the operation is complicated and the cost is high, but also whether the gene knockout is successful must also be considered. The more genes that are knocked out, the lower the success rate of gene knockout is likely to be. Once the knockout is incomplete, it will cause safety problems; ③Although the whole genome sequencing of African swine fever has been completed, the composition of the African swine fever virus There are as many as 151 regulatory genes and structural genes. A comprehensive study of the function of each regulatory gene and structural gene is crucial to its pathogenic mechanism and vaccine development. It can clarify the gene function, and then drive the transformation and improvement of vaccine seeds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Attenuated African swine fever viral strain with deficient natural immunosuppression genes and application
  • Attenuated African swine fever viral strain with deficient natural immunosuppression genes and application
  • Attenuated African swine fever viral strain with deficient natural immunosuppression genes and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Construction, purification and identification of recombinant virus MGF-Δ9L

[0064] 1. CRISPR / Cas9 vector construction

[0065] (1) Optimization of pX330 vector: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the nuclear localization at both ends of the Cas9 enzyme was removed by ClonExpress II one-step cloning method Signal (NLS), named pX330ΔN.

[0066] (2) Designing targeting gRNAs targeting the ASFV MGF-110-9L gene, the oligonucleotide names and sequences are: MGF1109L-gRNA-LF: CTCCTGTTCCTGGAAAAGATTGG' (shown in SEQ ID NO. 3) and MGF1109L-gRNA- RF: TTAATTGTACAGTTTCCCGGTGG (shown in SEQ ID NO. 4).

[0067] (3) Referring to the cloning method recommended in the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9 system. NatProtoc. 2013; 8(11): 2281-2308), The oligonucleotides MGF1109L-gRNA-LF an...

Embodiment 2

[0080] Example 2 ASFV MGF-110-9L Immunosuppression Experiment

[0081] HEK293 cells in good condition were digested with trypsin and plated in a 48-well plate, placed at 37°C, 5% CO. 2 The cells were cultured in an incubator for 12 hours, and Lipofectamine TM 2000 transfection was carried out when the cell density was nearly 70%-80%. 100ng of IFN-β reporter plasmid, 10ng of internal reference TK, and 100ng of MGF-110-9L plasmid (the ASFV MGF-110-9L gene was inserted into PCMV plasmid to obtain PCMV-MGF-110-9L plasmid) synchronously transfected into HEK293 cells, and 24h after transfection, the successfully transfected cells were retransfected with HT-DNA (1 μg / mL), transfected for 12h. At least three parallel holes were set in the experiment to ensure the reliability of the experimental results. Add 50 μL of 1×passive lysis buffer to each well and lyse at room temperature for 15-20 min. After sufficient lysis, detect the activity of dual-luciferase reporter gene. The resul...

Embodiment 3

[0082] Example 3 Titration of virus titers

[0083] 50% haemadsorption (HAD) was used for the titration of African swine fever virus. 50 ) method to operate. References (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine fever virus vaccine by deletion of the I177L generesults in sterile immunity against the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) for HAD 50 Experimental procedure, with appropriate adjustments: primary PBMCs (Mason, D.W., W.J. Penhale, and J.D. Sedgwick, 1987: Preparation of lymphocytes subpopulations. In: Klaus, G.G.B. (ed.) Lymphocytes: a Practical Approach , pp.35-54.IRL Press, Oxford.), the sample to be tested is subjected to 10-fold gradient dilution, and each hole is inoculated with 0.02ml, and the virus infection can be judged according to the rosette formed by the aggregation of red blood cells around the infected cells,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering and particularly relates to an attenuated African swine fever viral strain with deficient natural immunosuppression genes and application. According to the invention, it is discovered that ASFV MGF-110-9L has the function of inhibiting generation of interferon, through deleting the gene ASFV MGF-110-9L from an African swine fever original viral strain, the toxicity of parent viral strains can be lowered, and the attenuated African swine fever viral strain is obtained; and the toxicity of the attenuated African swine fever viral strain to pigs is debilitated remarkably, and thus, the safety of the viral strain is improved. Through deleting the gene ASFV MGF-110-9L from the parent viral strains, the toxicity of the parent viral strains is lowered, and theoretical basis and practice reference are provided for successfully preparing African swine fever vaccines in the future; and researchers can finally prepare safe and effective African swine fever vaccine candidate strains through simultaneously knocking out the ASFV MGF-110-9L and one or more disclosed toxic genes (for example, CD2V, MGF360-12L, MGF360-13L, MGF360-14L and MGF360-505R).

Description

[0001] This application claims the priority of an earlier application with an application date of March 29, 2020, an application number of CN202010233449.8, and the title of the invention "An attenuated African swine fever virus strain with deletion of a natural immunosuppressive gene and its application", The entire content of that earlier application is incorporated into the present application. technical field [0002] The invention belongs to the technical field of bioengineering, and in particular relates to an attenuated African swine fever virus strain lacking a natural immunosuppressive gene and an application thereof. Background technique [0003] African Swine Fever (ASF) is an acute and severe infectious disease caused by African Swine Fever Virus (ASFV) infection, characterized by fever and hemorrhage of pigs' systemic organs. The fatality rate for domestic pigs is as high as 100%. . The disease first broke out in Kenya in 1921 and subsequently became widespread...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/34C12N7/01A61K39/12A61P31/20
CPCA61K39/12A61K2039/5254A61K2039/552A61P31/20C07K14/005C12N7/00C12N2710/12022C12N2710/12034
Inventor郑海学李丹李攀齐晓兰张克山茹毅杨吉飞田宏杨帆申超超刘志杰吴森党文殷宏刘湘涛
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI