Attenuated African swine fever viral strain with deficient natural immunosuppression genes and application
An African swine fever virus and gene deletion technology, applied in the field of bioengineering, can solve the problems of complex operation, low virus titer, and many knockout virulence genes.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1 Construction, purification and identification of recombinant virus MGF-Δ9L
[0064] 1. CRISPR / Cas9 vector construction
[0065] (1) Optimization of pX330 vector: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the nuclear localization at both ends of the Cas9 enzyme was removed by ClonExpress II one-step cloning method Signal (NLS), named pX330ΔN.
[0066] (2) Designing targeting gRNAs targeting the ASFV MGF-110-9L gene, the oligonucleotide names and sequences are: MGF1109L-gRNA-LF: CTCCTGTTCCTGGAAAAGATTGG' (shown in SEQ ID NO. 3) and MGF1109L-gRNA- RF: TTAATTGTACAGTTTCCCGGTGG (shown in SEQ ID NO. 4).
[0067] (3) Referring to the cloning method recommended in the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9 system. NatProtoc. 2013; 8(11): 2281-2308), The oligonucleotides MGF1109L-gRNA-LF an...
Embodiment 2
[0080] Example 2 ASFV MGF-110-9L Immunosuppression Experiment
[0081] HEK293 cells in good condition were digested with trypsin and plated in a 48-well plate, placed at 37°C, 5% CO. 2 The cells were cultured in an incubator for 12 hours, and Lipofectamine TM 2000 transfection was carried out when the cell density was nearly 70%-80%. 100ng of IFN-β reporter plasmid, 10ng of internal reference TK, and 100ng of MGF-110-9L plasmid (the ASFV MGF-110-9L gene was inserted into PCMV plasmid to obtain PCMV-MGF-110-9L plasmid) synchronously transfected into HEK293 cells, and 24h after transfection, the successfully transfected cells were retransfected with HT-DNA (1 μg / mL), transfected for 12h. At least three parallel holes were set in the experiment to ensure the reliability of the experimental results. Add 50 μL of 1×passive lysis buffer to each well and lyse at room temperature for 15-20 min. After sufficient lysis, detect the activity of dual-luciferase reporter gene. The resul...
Embodiment 3
[0082] Example 3 Titration of virus titers
[0083] 50% haemadsorption (HAD) was used for the titration of African swine fever virus. 50 ) method to operate. References (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine fever virus vaccine by deletion of the I177L generesults in sterile immunity against the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) for HAD 50 Experimental procedure, with appropriate adjustments: primary PBMCs (Mason, D.W., W.J. Penhale, and J.D. Sedgwick, 1987: Preparation of lymphocytes subpopulations. In: Klaus, G.G.B. (ed.) Lymphocytes: a Practical Approach , pp.35-54.IRL Press, Oxford.), the sample to be tested is subjected to 10-fold gradient dilution, and each hole is inoculated with 0.02ml, and the virus infection can be judged according to the rosette formed by the aggregation of red blood cells around the infected cells,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


