A wheat thiosynthase thi1 gene and its application in plant resistance to Chinese wheat mosaic virus

A technology of wheat mosaic virus and synthetase, applied in the field of plant genetic engineering

Active Publication Date: 2022-03-22
NINGBO UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no antiviral application of the thiazosynthase THI1 gene at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A wheat thiosynthase thi1 gene and its application in plant resistance to Chinese wheat mosaic virus
  • A wheat thiosynthase thi1 gene and its application in plant resistance to Chinese wheat mosaic virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Cloning Method of Wheat Thiamine Thiamine Synthase Gene

[0025] First, the total RNA of Yangmai 158 wheat leaves was extracted using the HiPure Plant RNA Mini Kit (Magen), and the extracted total RNA was quantified to 1 μg, and then reverse transcription was performed using the First Strand cDNA Synthesis Kit ReverTra Ace (TOYOBO) The cassette was reverse-transcribed according to the manufacturer's instructions, and the reverse-transcribed wheat cDNA was used to amplify the thiamine thiamin synthase gene.

[0026] The primers were designed as F: ATGGCAGCCATGGCCACCACC (SEQ ID NO: 3); R: GGCGTCCACGATGTCGCCGTT (SEQ ID NO: 4). KOD FX (TOYOBO) high-fidelity enzyme was used to clone the wheat thiamine thiamine synthase gene from the reverse-transcribed cDNA. The reaction conditions were set as follows: 95°C pre-denaturation for 5min, 95°C for 30sec, 56°C for 30sec, 72°C for 90sec, 40 cycles. The reaction system is: 2×Buffer 12.5 μL, 2mM dNTPs 2.5 μL, forward primer F 0.5 μ...

Embodiment 2

[0028] According to the primer sequence in Example 1, a gateway universal adapter (GGGGACAAGTTTGTACAAAAAAGCAGGCTTC (SEQ ID NO: 5) / GGGGACCACTTTGTACAAGAAAGCTGGGTC (SEQ ID NO: 6)) was added to the 5' end of the primer respectively to obtain the primers with the adapter (forward and reverse primers F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAGCCATGGCCACCACC (SEQ ID NO: 7); R: GGGGACCACTTTGTACAAGAAAGCTGGGTCGGCGTCCACGATGTCGCCGTT (SEQ ID NO: 8)), respectively. The gene encoding wheat thiamine thiamine synthetase was amplified by primers with linkers, and the method was the same as in Example 1 to obtain the amplified fragments with linkers. The amplified fragments with adapters were subjected to BP reaction with BP enzyme (Invitrogen Company), and the reaction procedure was as follows: 1 μL of proteinase K was added after treatment at 25° C. for 1 hour, and then treated at 37° C. for 10 minutes. The reaction system is: 2 μL of amplified fragment with adapter, 1 μL of pDONR207 vector, 1 μ...

Embodiment 3

[0030] The pGWB408-THI1 vector containing the thiamine thiamine synthetase gene sequence is transformed into the immature wheat embryo by the method of genetic transformation of wheat mediated by a gene gun, and the steps are as follows:

[0031] 1) Collect immature wheat seeds 13-15 days after pollination (the color of the seeds is whitish with a little green, the embryo is slightly formed with weak protrusions, and the scutellum is about 1 cm), and the immature embryos are inoculated in SD2 medium after being sterilized by 10% NaClO solution. Culture in a dark environment at 24-26°C;

[0032] 2) After 7-8 days of dark culture, select immature embryo calli in good condition, place them centrally in the center of a petri dish containing 0.4M osmotic pressure medium, and place about 38 immature calli within a diameter of 2.5cm. Embryo callus, osmotic pretreatment for 4-6 hours;

[0033] 3) Mix pAHC20 empty plasmid and pGWB408-THI1 recombinant plasmid at a volume ratio of 1:1, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a wheat thiazosynthase THI1 gene and its application in plant resistance to Chinese wheat mosaic virus, belonging to the technical field of plant genetic engineering. The nucleotide sequence of the wheat thiazolinase THI1 gene provided by the present invention is shown in SEQ ID NO:1. The invention transfers the wheat thiazolinase THI1 gene into the wheat plant to overexpress the wheat thiazolinase THI1 gene in the plant, thereby improving the resistance of the transgenic wheat plant to the Chinese wheat mosaic virus. Therefore, the present invention provides the application of the wheat thiazosynthase THI1 gene and its recombinant vector and encoded protein in plant resistance to Chinese wheat mosaic virus.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to a wheat thiazosynthase THI1 gene and its application in plant resistance to Chinese wheat mosaic virus. Background technique [0002] Chinese wheat mosaic virus (CWMV) is one of the important pathogens that can cause wheat mosaic virus disease in my country. It is transmitted by polymyxa gramineis (Ploymyxa graminis) obligately parasitic on plant roots. Since the spores of Polymyxa graminearum have strong stress resistance, on the one hand, the poisonous Polymyxa graminearum infects the plant and continuously replicates in the host to cause the plant to become ill; When the slime mold infects the infected plants, it acquires the virus and becomes a new source of disease. Therefore, the diseased soil containing CWMV can maintain long-term pathogenicity, and the wheat planting areas in my country such as Shandong, Henan, and Jiangsu have been affected ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/82A01H5/00A01H6/46
CPCC12N9/13C12N15/8283C12Y208/0101
Inventor杨锦羊健刘芃陈剑平
OwnerNINGBO UNIV