Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for identifying plateau zokor

A kit and reagent technology, applied in the field of identification, can solve the problems of difficulty in distinguishing between species and difficulty in accurate identification of species, and achieve the effect of accurate and reliable results.

Pending Publication Date: 2021-10-01
CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the similar living environment and similar morphology of different zokors, it is difficult to distinguish between species, and it is very difficult to accurately identify species through morphology without professional training

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for identifying plateau zokor
  • Kit and method for identifying plateau zokor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the present invention distinguishes the kit of plateau zokor

[0042] The components of the kit of the present invention include:

[0043] (1) PCR amplification reagents: primer pairs comprising SEQ NO: 1-2; (2) Reagents for sequencing.

Embodiment 2

[0044] Embodiment 2, PCR primer design and verification of SNP site

[0045] The applicant compared the mitochondrial genome sequences of 121 zokor individuals from 8 zokor species, and found that there were 2 plateau zokor species-specific SNP genotypes in the 12SrRNA gene, and there were conserved sequences at both ends of these 2 SNP sites. Therefore, the 12S rRNA gene fragment was identified as the DNA barcode for plateau zokor species identification.

[0046] 121 individual zokors from 8 zokor species: 12 prairie zokors, 10 northeast zokors, 15 Chinese zokors, 18 Schneider zokors, 16 Roche zokors, 14 plateau zokors, Gansu zokors There were 24 rats and 12 Qinling zokors.

[0047] The 12S rRNA and nearby gene sequences were designed with primers in the conserved region as follows:

[0048] ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1);

[0049] ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).

[0050]DNA samples of different zokor species were amplified using the above ...

Embodiment 3

[0054] Embodiment 3, plateau zokor species identification

[0055] First, 12S rRNA primer pairs were synthesized: ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1); ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).

[0056] Use the following methods to identify:

[0057] a) Using the Qiagen DNeasy Blood&Tissue Kit kit, extract the total genome DNA of zokor muscle tissue numbered CD-8; the total genomic DNA of zokor muscle tissue numbered ASX-1; the zokor numbered HX-3 Genomic total DNA from mouse liver tissue;

[0058] b) Using the total genomic DNA described in step a) as a template, use the 12S rRNA primer pair to perform PCR reaction, CD-8 reaction system 25 μL, annealing temperature 52 ° C; ASX-1 reaction system 25 μ L, annealing temperature 55 ° C; HX-3 reaction system 50μL, annealing temperature 56℃;

[0059] c) 1% agarose gel electrophoresis detection is performed on the PCR product obtained in step b), and a bright band of about 490bp is observed;

[0060] d) performing...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for identifying plateau zokor. The kit comprises a reagent for detecting any one or two SNP (single nucleotide polymorphism) sites in 12S rRNA (ribosomal Ribonucleic Acid) genes of species to be detected: the first site and the second site of a conservative motif sequence as shown in SEQ ID NO: 3. The invention provides the kit for simply, conveniently and accurately identifying the species of the plateau zokor and the method for identifying the plateau zokor, so that the problem of identifying the species of the zokor through forms is solved, and the kit has excellent application prospects in identifying the species of the zokor.

Description

technical field [0001] The invention belongs to the technical field of identification, and in particular relates to a kit and a method for identifying plateau zokors. Background technique [0002] Zokor is a general term for animals in the subfamily Myospalacinae, mainly distributed in China and southern Siberia. Existing zokors include the genus Eospalax and the genus Myspalax, and almost all extant zokor species are distributed in my country. Flat-headed zokors include 2-3 species such as prairie zokor (M.aspalax) and northeast zokor (M.psilurus). There are 6 species of zokor (E.smithi), zokor (E.rothschildi), plateau zokor (E.baileyi), Gansu zokor (E.cansus) and Qinling zokor (E.rufescens). Zokors live in closed underground tunnel systems almost all their lives, and their unique underground lifestyle makes them special in foraging, mating, breeding and other aspects, which has aroused widespread interest of scientists. [0003] The dry whole skeleton of the plateau zok...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6888C12Q1/6858C12Q2600/156C12Q2531/113C12Q2535/101C12Q2565/125
Inventor 蔡振媛张同作江峰苍浩马旭康高红梅宋鹏飞汪海静侯陆一徐波
Owner CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com