Culture medium for directionally inducing and differentiating pluripotent stem cells into hepatocytes as well as culture method and application

A technology of pluripotent stem cells and induced differentiation, applied in the field of directional induction and differentiation of pluripotent stem cells into hepatocytes, which can solve the problems of unsatisfactory cell integration efficiency and low maturity of iHeps

Active Publication Date: 2022-05-13
SHENZHEN SANQI BIOTECH
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in fact, due to the low maturity of iHeps differentiated from human iPSC and other pluripotent stem cells through serum-free medium, their cell integration efficiency in mouse liver transplantation is still not ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Culture medium for directionally inducing and differentiating pluripotent stem cells into hepatocytes as well as culture method and application
  • Culture medium for directionally inducing and differentiating pluripotent stem cells into hepatocytes as well as culture method and application
  • Culture medium for directionally inducing and differentiating pluripotent stem cells into hepatocytes as well as culture method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Example 1 sgRNA sequence and donor plasmid construction

[0091] Donor construct (Donor construct) design see figure 2 . Donor plasmids include LHA-P2A-mCherry-loxP-PGK-PuroR-loxP-RHA; where LHA is the left homology arm, P2A is a self-cleaving 2A peptide, mCherry is a fluorescent protein, and loxP is the loxP site Point, PGK is the mammalian promoter derived from the phosphoglycerate kinase gene, PuroR is the puromycin resistance gene pac, and RHA is the right homology arm.

[0092] according to figure 2 Design vector, insert P2A-mCherry-loxP-PGK-PuroR-loxP expression frame before ASGR1 stop codon, design process is as follows: design left and right arm (LHA, RHA) primer ASGR1-LARM-PF: CTGgaattcCTCCACGTGAAGCAGTTCGT, as SEQ ID NO: 1; ASGR1-LARM-PR: GCGgctagcAAGGAGAGGTGGCTCCTGGCTG, as shown in SEQ ID NO: 2, ASGR1-RARM-PF: GTGgctagcGTCggcgcgccTTTATTTCTTCAATGCCTCGACCTGC, as shown in SEQ ID NO: 3; ASGR1-RARM-PR: GTGaagcttCACTCAACAANOATTCGGGTGGT, as shown in SEQ ID : Sh...

Embodiment 2

[0103] Example 2 ASGR1-mCherry cell line construction

[0104] 1) The first step of screening

[0105] 2.5ug ASGR1 targeting vector and 2.5ug ASGR1 CRISPR-Cas9 vector were transfected into 800,000 hiPSCs by nucleofection, and plated into one well of a 6-well plate. On Day 4, 0.05-1 mg / ml puromycin was added until 99% of the cells died. On Day 5, the puromycin was removed and the mTeSR1 medium was replaced, and the clones were identified when they grew to a suitable size, and the primers F1 / R1 were identified: AGACGGGCTTCAAGTGAGTG (as shown in SEQ ID NO:13) / CCTGCTTCCGAATCCCCAAT (as shown in SEQ ID NO:14), F2 / R2:GGATGTAGGGCTGACCTCGTT (as shown in SEQ ID NO:15) / ACAGCTTCAAGTAGTCGGGG (as shown in SEQ ID NO:16) , F3 / R3: GGTGCATGACCCGCAAGCCC (shown in SEQ ID NO: 17) / TTTGTTGCTTCTGTTCCGCAG (shown in SEQ ID NO: 18). Such as Figure 5 , the target clone was screened by Junction PCR, and the No. 20 single-cell-derived clone with both alleles (alleles) modified was selected for the next...

Embodiment 3

[0108] Example 3 Hepatocyte (iHeps) Differentiation

[0109] In this example, the hiPSCs (20#-13#) obtained in Example 2 were differentiated into iHeps through three stages. 1) In the first stage, hiPSCs were treated with RPMI1640+Activin A (100ng / mL) and WNT3α (20ng / mL) for 24 hours (Day 0), and then the first stage medium without WNT3α was used for the next 2 days (Day1-Day2). In this way, Definitiveendoderm (DE) can be induced for three days. 2) The second stage is to induce DE into hepatoblasts. This stage uses the second stage medium to culture from day3 to day9. The second stage medium composition: 80% knockout DMEM (KO-DMEM), 20% knockout serum replacement (KSR) , 0.5% GlutaMAX, 1% non-essential amino acids (NEAA), 0.1 mM beta-mercaptoethanol and 1% DMSO. 3) Subsequently, on Day 10, the medium S3 of the third stage was replaced and cultured for 7 days or more. S3 medium contained hepatoZYME-SFM, 1% GlutaMAX, 10 μM hydrocortisone 21-hemisuccinatesodium salt (HCC), 20....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of cell engineering, in particular to a culture medium for directional induced differentiation of pluripotent stem cells into hepatocytes, a culture method and application. The invention provides a culture medium composition, the culture medium composition contains an adenylate cyclase activator, an ALK5 inhibitor, a growth factor, OSM and other factors, and the maturity of hepatocytes obtained by induced differentiation of iPSC can be greatly improved by using the culture medium. The ASGR1 + cell proportion is increased, and the ALB secretion level is increased. A reporter gene is added into an ASGR1 gene by utilizing a gene editing and recombination technology, a vector containing the two genes is introduced into the pluripotent stem cell, and after the pluripotent stem cell is induced to be differentiated into the hepatocyte, the reporter gene and the ASGR1 are co-expressed, so that the proportion of ASGR1 + hepatocyte subpopulation in differentiated cells is favorably detected, the ASGR1 + cell population is detected or sorted by utilizing FACS, and the detection accuracy of the pluripotent stem cell is improved. Extra experimental operation is not needed, the cells can be directly detected or sorted on a machine after being digested, and high-throughput detection can be realized by utilizing the detection method disclosed by the invention.

Description

technical field [0001] The invention relates to the technical field of cell engineering, in particular to a culture medium for directional induction and differentiation of pluripotent stem cells into hepatocytes, a culture method and application. Background technique [0002] Pluripotent stem cells include embryonic stem cells and induced pluripotent stem cells (iPSCs). In 2006, Shinya Yamanaka transfected mouse fibroblasts with four transcription factors OCT3 / 4, SOX2, MYC and KLF4 at Kyoto University to transform them into mouse embryonic stem cells in morphology, gene expression, expansion ability, class Embryonic bodies and teratomas are very similar cell types in terms of their ability to generate and differentiate. Human induced pluripotent stem cells were successfully induced the following year. Human pluripotent stem cells have the potential of self-renewal and multi-directional differentiation, and are important seed cells in regenerative medicine. [0003] Under ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/071G01N21/64
CPCC12N5/067G01N21/6486C12N2506/45C12N2501/10C12N2501/20C12N2500/30C12N2500/40C12N2501/999
Inventor付建江利香杨佳银刘雨晴
OwnerSHENZHEN SANQI BIOTECH