Reagent and method for improving quality of Agrin protein immunofluorescence flaking and application

An immunofluorescence and reagent technology, applied in the field of reagents to improve the quality of Agrin protein immunofluorescence production, can solve the problems of poor growth of Agrin protein crawling cells, poor live cell immunofluorescence signal, etc., and achieve the enhancement of live cell immunofluorescence signal, Improve poor quality and reduce secretion

Active Publication Date: 2022-05-13
SHAANXI MYBIOTECH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows us to improve how well an antigen-specific fluorophore (AGF) works when attached or placed onto surfaces like glass plates during research studies. By adding certain substances called lanthanum oxide nano particles into this solution, we were able to create AGFs with specific properties such as high quantum yield and strong binding ability towards other molecules involved in biological processes. These technical improvements resulted in improved detection efficiency and reduced interference from unwanted signals associated with these materials used in experiments.

Problems solved by technology

The technical problem addressed by this patents relating to neurological disorders caused by glutamergis spina parallels or gliosis involves identifying these conditions through biomedical researches involving studying neural mechanisms involved in nerve conductions called nicotube cells. These connections play crucial roles during development and functioning within nervous system organs like brain stem axons. To identify any potential sources of autism spectrum disease(ASPD)-associated Amyotrophy Graft Reaction (AMGR)/Lrp3-binding protein-4 associated factor-19a (LMZ19-) binding site, there have been previous studies exploring various techniques based upon specific molecules from different origins: laminopathrin heavy chain containing domain 1; α-synuclein containing one long arm stretching motif sequence repeated unit around residue 301-3); beta-2 microglobulocyte stimulating hormone type I receptors located at chromatin sites near certain genes encoding alpha subunit 21 ; ubiquitination complex carboxypeptide transferring factors (UCFs) found throughout many tissues types. This helps control how much stress fibers connect to each other and maintain their structural integrity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent and method for improving quality of Agrin protein immunofluorescence flaking and application
  • Reagent and method for improving quality of Agrin protein immunofluorescence flaking and application
  • Reagent and method for improving quality of Agrin protein immunofluorescence flaking and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Agrin affects cell migration / proliferation

[0044] Step 1. Agrin expression plasmid vector construction

[0045] 1. Gene synthesis

[0046] The Agrin gene sequence was obtained from the GenBank sequence database, and the gene sequence was synthesized.

[0047] 2. Vector construction

[0048] The target gene Agrin was connected to the pcDNA3.1 vector, and the enzyme cutting sites were selected to be NheI and XbaI. After the sequencing was correct, the plasmid was extracted for subsequent transfection. The specific construction steps are as follows:

[0049] 2.1. Using the plasmid containing the target gene Agrin (6207bp) as a template, the upstream primer Agrin-NheI-F: atccGCTAGCGCCGCCACCatggccggccggtcccacccggg (SEQ ID NO.5), the downstream primer Agrin-XbaI-R: TGCTCTAGATCATGGGGTGGGGCAGGGCCGC (SEQ ID NO.6), PCR Amplified the Agrin gene;

[0050] PCR amplification system (50μl): template 50ng, Agrin-NheI-F (10μM) 1μl, Agrin-XbaI-R (10μM) 1μl, FastPfu DNA Polymerase ...

Embodiment 2

[0073] Detection of Agrin cell proliferation

[0074] Add small slides to a 10cm cell culture dish, after PDL treatment, inoculate cells, culture overnight, transfect Agrin expression plasmid (6ug) and control pcDNA3.1 (6ug) the next day, transfection steps are the same as in Example 1, without Special limited. After 48 hours of transfection, the small slides were taken out and placed in a 96-well plate, and the cell proliferation was measured with a CCK-8 kit (purchased from Beyotime Biotechnology Company), and three groups of repeated experiments were set up.

[0075] Experimental results such as Figure 4 As shown, compared with the control group, the proliferation of cells transfected with Agrin was significantly reduced. That Agrin affects the growth of cells.

Embodiment 3

[0077] Validation of the Agrin protein signal secreted into the cell supernatant

[0078] The Agrin expression plasmid and the control pcDNA3.1 were transfected, and the cell supernatants were collected after 24 hours of culture, and then added to DMEM medium to continue culture for 96 hours, and the supernatants were collected respectively. Centrifuge the collected cell supernatant at 1000 rpm for 5 min, discard the precipitate, spot the centrifuged supernatant on the NC membrane, dry at 37°C, and verify the signal by immunospotting. The specific steps are as follows:

[0079] 1. Place the dried NC membrane in a clean 12-well plate, with the sample side facing up. Dilute the commercial Agrin antibody at 1:1000, add 200ul diluted antibody to the well with NC membrane, and incubate at room temperature for 30min;

[0080] 2. Wash with the working solution 3 times, 5 minutes each time;

[0081] 3. Incubate alkaline phosphatase (AP)-labeled goat anti-rabbit secondary antibody fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a reagent and a method for improving the quality of an Agrin protein immunofluorescence sheet and application, and belongs to the technical field of antibody detection. The invention provides an application of a reagent for preventing secretory expression of Agrin protein in improving the quality of an Agrin protein immunofluorescence sheet. According to the application disclosed by the invention, the Agrin can be positioned on a cell membrane by utilizing the interaction of the LRP4 and the Agrin, and the secretion of the Agrin is reduced, so that the influence of the secreting type Agrin on cells is reduced, the problem of poor quality of an Agrin immunofluorescence sheet is solved, and a living cell immunofluorescence signal can be obviously enhanced.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
OwnerSHAANXI MYBIOTECH CO LTD