Cells with sustained transgene expression

A transgenic and cell technology, applied in genetically modified cells, artificially induced pluripotent cells, embryonic cells, etc., and can solve problems such as low-level transgene expression

Pending Publication Date: 2022-07-15
블루록테라퓨틱스엘피
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, transgene expression using the promoters of these housekeeping genes may ultimately result in low or negligible levels of transgene expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cells with sustained transgene expression
  • Cells with sustained transgene expression
  • Cells with sustained transgene expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0135] Example 1: Identification of STEL sites

[0136] In this study, we evaluated single-cell RNA-sequencing (scRNA-seq) data collected from human PSCs and their differentiated derivatives for a locus survey of STEL candidates. We hypothesized that it might be possible to discover putative STEL sites using scRNA-seq data from multiple cell types. This approach will allow direct examination of hundreds of thousands of available individual transcriptomes. In the current study, single-cell RNA-seq data were collected from PSCs and three PSC-derived cell types: microglia, dopaminergic neurons, and ventricular cardiomyocytes. Data were collected from 267,058 cells with transcriptome depth of 28,387 unique genes. The first characteristic of STEL loci is the ubiquity of expression. Genes were ranked according to prevalence of expression by first binarizing the transcript count data and then summing across cells. The sum of each gene was then divided by the total number of cells...

Embodiment 2

[0145] Example 2: Expression of EGFP at STEL sites in PSCs

[0146] Based on the above studies, we selected four STEL loci (GAPDH, RPL13A, RPLPO and RPL7) to test payload candidates for expression. The expression cassettes for the payload candidates are controlled by the endogenous STEL promoter. Thus, the expression of the payload candidates correlates with the expression of the endogenous STEL gene. If the STEL promoter remains active in the cell, expression of the associated payload transgene would be expected to be persistent and constitutive. We used CRISPR-cas9 gene editing to insert constructs expressing enhanced green fluorescent protein (EGFP) at the GAPDH, RPL13A, RPLP0, or RPL7 loci ( figure 2 ). The EGFP coding sequence is shown below.

[0147] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGC...

Embodiment 3

[0168] Example 3: Expression of HLA-G6 at the GAPDH and RPL13A loci in iPSCs

[0169] In this study, constructs expressing HLA-G6 were edited into either the GAPDH locus or the RPL13A locus in iPSCs. The HLA-G6 coding sequence is shown below.

[0170] ATGGTGGTCATGGCGCCCCGAACCCTCTTCCTGCTGCTCTCGGGGGCCCTGACCCTGACCGAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCAGCGCCGCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCATGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACTCGGCGTGTCCGAGGATGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGAAGAGGAGACACGGAACACCAAGGCCCACGCACAGACTGACAGAATGAACCTGCAGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCAACCCCCCCAAGACACACGTGACCCACCACCCTGTCTTTGACTATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCATACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACGTGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGGCTGCCGGAGCCCCTCATGCTGAGATGGAGTAAGGAGGGAGATGGAGGCATCATGTCTGTTAGGGAAAGCAGGAGCCTCTCTGAAGACCTTTAA(SEQ ID NO:18)

[0171] The inserted HLA-G6 transgene i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Provided herein are genetically engineered mammalian (e.g., human) cells that express one or more transgenes at sustained expression levels. Methods of making and using the cells are also provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS [0002] This application claims priority to US Provisional Application No. 62 / 913,062, filed on October 9, 2019, the contents of which are incorporated herein by reference in their entirety. [0003] sequence listing [0004] This application contains a Sequence Listing that has been electronically filed in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on October 9, 2020, named 025450_WO009_SL.txt, and is 29,071 bytes in size. [0005] Background of the Invention [0006] Cell therapy offers great promise for the treatment of a variety of diseases and conditions. In cell therapy, autologous or allogeneic cells are transplanted into a patient to replace or repair defective or damaged tissue or cells. A variety of different types of cells can be used, such as pluripotent stem cells (PSCs), multipotent stem cells (eg, hematopoietic stem cells and mesenchymal stem cells), or differ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N5/077C12N5/074A61K35/17A61K35/545A61K38/19A61P29/00A61P35/00A61P37/06
CPCC12N5/0657C12N5/0696A61K35/545A61K38/193A61P29/00A61P37/06A61P35/00C12N2510/00C12N2506/45A61K39/464A61K39/461C12N5/0634C12N15/85C12N5/0606C12N5/0618A61K35/30A61K35/34A61K35/37C12N9/0008C12N9/1211C12Y102/01012C12Y207/01021
Inventor C-L.苏M.J.托米西玛D.C.小威尔金斯C.B.麦考利夫
Owner 블루록테라퓨틱스엘피
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap