Check patentability & draft patents in minutes with Patsnap Eureka AI!

Riemerella anatipestifer mutant strain with Cas9 gene deletion and applications of riemerella anatipestifer mutant strain

A technology of gene deletion and Ribella, which is applied in the direction of vaccines, bacteria, antibacterial drugs, etc., can solve the problems of no products coming out, and no Ribella anatipestifer has yet been seen, and achieve low production costs, simple cultivation methods, and simple operations fast effect

Inactive Publication Date: 2016-12-07
HUAZHONG AGRI UNIV
View PDF4 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, scholars at home and abroad have begun to study R. anatipestifer as a live attenuated vaccine, but so far no relatively mature product has come out.
In addition, live bacterial vaccines are mainly immunized by intramuscular and subcutaneous injections, and there are no reports of commercial attenuated live bacterial vaccines immunized by nasal drops.
[0006] So far, there has been no research report on the CRISPR-Cas system of R. anatipestifer. Through the bioinformatics analysis of the genome of R. anatipestifer, it was found that in the R. anatipestifer Yunmeng strain (RA-YM) There is a type II-C CRISPR-Cas system, and its marker gene is Cas9

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Riemerella anatipestifer mutant strain with Cas9 gene deletion and applications of riemerella anatipestifer mutant strain
  • Riemerella anatipestifer mutant strain with Cas9 gene deletion and applications of riemerella anatipestifer mutant strain
  • Riemerella anatipestifer mutant strain with Cas9 gene deletion and applications of riemerella anatipestifer mutant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Obtaining the gene deletion mutant strain of R. anatipestifer:

[0036] 1. Amplified cloning of left and right homology arms of RA-YM Cas9 gene

[0037] According to the RA-YM genome sequence provided by NCBI, two pairs of primers were designed using Premier 5.0 (all primers were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd.) to amplify its left and right arms that can be used for Overlap PCR. A Kpn I restriction site was added to the 5'-end of the upstream primer L1 of the Leftarm, and a Sac I restriction site was introduced to the 5'-end of the downstream primer R2 of the Rightarm. The primer sequences are as follows:

[0038] Leftarm L1: 5'CTGGTACCTGTTTTTTTAGCAACCTAACGGGAG 3'

[0039] Leftarm L2: 5'GTTTCGTTCCACTGCCTAAGTCTAATCCAAGTATGG 3'

[0040] Primer L1 / L2 amplifies the upstream homology arm 987bp

[0041] Rightarm R1: 5'GAAAATTTTGATGACGGCAAACCCGATGAAGTGCGT 3'

[0042] Rightarm R2: 5' AGAGCTCTCTAAAGTTAGGCATTGGTGG 3'

[0043] Primer R1 / R2 amplif...

Embodiment 2

[0074] LD of RA-YMCas9 gene deletion strain 50 determination

[0075] The RA-YM Cas9 gene deletion strain of the present invention and the control parent strain RA-YM were cultivated on the TSA modified medium, and single colonies were cultured overnight at 37°C in the TSB improved medium, and then the overnight cultured RA-YM Cas9 gene The deletion strain and the wild strain RA-YM strain were transferred to TSB medium at a ratio of 1:100, cultured with shaking at 200 r / min at 37°C, and the OD 600 When reaching 0.8, collect bacteria, wash three times with sterilized phosphate buffered saline (PBS), adjust its OD 600 to 1.0, counted by the plate method. Then press 10 times equidistant from 10 5 -10 9 After dilution of CFU, 12-day-old ducklings were inoculated by flipper injection, and the control group was injected with the same amount of sterilized phosphate buffered saline (PBS) in the same way. Each inoculated with 0.5mL, generally within 24 hours after inoculation, the...

Embodiment 3

[0082] Transcriptome sequencing analysis of RA-YM Cas9 gene deletion mutant strain

[0083] The RA-YMΔCas9 strain and the wild strain RA-YM were cultured on TSA medium, and the single colony was cultured in TSB medium at 37°C overnight, and then transferred to TSB medium at a ratio of 1:100, 37°C 200r / Min shaking culture, until its OD 600 When it reaches 0.8, collect the bacteria, extract RNA, and then send the RNA samples of RA-YMΔCas9 and RA-YM strains with qualified concentrations to Hengchuang Gene Technology Co., Ltd. for transcriptome sequencing.

[0084] The differentially expressed genes between the RA-YMΔCas9 strain and the parental strain RA-YM were analyzed by transcriptome sequencing. The results showed that there were 500 genes with 2-fold or more expression difference between the two, and 336 genes were up-regulated in the deletion strain. Further analysis found that there was an up-regulated lipoprotein gene (RAYM_RS04770) in the deletion strain, which has be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a riemerella anatipestifer mutant strain with Cas9 gene deletion and applications of the riemerella anatipestifer mutant strain, belonging to the technical field of preparation of animal genetically engineered vaccines. The strain is preserved in the China Center for Type Culture Collection (CCTCC), and is assigned with the accession number of CCTCC NO:M 2016247. According to the strain, 2070bp of the Cas9 gene of the CRISPR-Cas system is deleted, so that the toxicity of the bacterial strain is obviously reduced, but the good immunogenicity is still reserved. Compared with the traditional inactivated vaccines, the strain with the Cas9 gene deletion has the advantages that the culture method is simple, the production cost is low, the inoculation can be carried out through the manners of nasal inhalation, mist spraying and the like, the operation is simple and rapid, the body can be stimulated to generate effective mucosal immunity, and meanwhile, the systemic immunity of the body also can be stimulated.

Description

technical field [0001] The invention belongs to the technical field of animal bacterial genetic engineering, and relates to related fields such as animal molecular biology, microbiology, and immunology. Specifically, it relates to a Cas9 gene deletion mutant strain of R. anatipestifer and an application thereof. Background technique [0002] Riemerella anatipestifer is an acute, contact, septic infectious disease caused by Riemerella anatipestifer (RA), which mainly occurs in ducks aged 1-8 weeks, especially 2- 3-week-old ducklings are the most susceptible. The disease is characterized by fibrinous pericarditis, perihepatitis, air sacculitis and meningitis, and is one of the most serious bacterial infectious diseases that endanger the duck industry. Diseased ducks have caused huge economic losses to the duck industry due to high mortality, stunted growth, reduced quality, low feed remuneration and increased treatment costs. There are many RA serotypes. At present, 21 sero...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A61K39/02A61P31/04C12R1/01
CPCA61K39/02A61K2039/522A61K2039/552C12N1/205C12R2001/01
Inventor 李自力殷学焕王颖薛雨琴周祖涛毕丁仁胡思顺刘梅石徳时
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More