Riemerella anatipestifer mutant strain with Cas9 gene deletion and applications of riemerella anatipestifer mutant strain
A technology of gene deletion and Ribella, which is applied in the direction of vaccines, bacteria, antibacterial drugs, etc., can solve the problems of no products coming out, and no Ribella anatipestifer has yet been seen, and achieve low production costs, simple cultivation methods, and simple operations fast effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Obtaining the gene deletion mutant strain of R. anatipestifer:
[0036] 1. Amplified cloning of left and right homology arms of RA-YM Cas9 gene
[0037] According to the RA-YM genome sequence provided by NCBI, two pairs of primers were designed using Premier 5.0 (all primers were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd.) to amplify its left and right arms that can be used for Overlap PCR. A Kpn I restriction site was added to the 5'-end of the upstream primer L1 of the Leftarm, and a Sac I restriction site was introduced to the 5'-end of the downstream primer R2 of the Rightarm. The primer sequences are as follows:
[0038] Leftarm L1: 5'CTGGTACCTGTTTTTTTAGCAACCTAACGGGAG 3'
[0039] Leftarm L2: 5'GTTTCGTTCCACTGCCTAAGTCTAATCCAAGTATGG 3'
[0040] Primer L1 / L2 amplifies the upstream homology arm 987bp
[0041] Rightarm R1: 5'GAAAATTTTGATGACGGCAAACCCGATGAAGTGCGT 3'
[0042] Rightarm R2: 5' AGAGCTCTCTAAAGTTAGGCATTGGTGG 3'
[0043] Primer R1 / R2 amplif...
Embodiment 2
[0074] LD of RA-YMCas9 gene deletion strain 50 determination
[0075] The RA-YM Cas9 gene deletion strain of the present invention and the control parent strain RA-YM were cultivated on the TSA modified medium, and single colonies were cultured overnight at 37°C in the TSB improved medium, and then the overnight cultured RA-YM Cas9 gene The deletion strain and the wild strain RA-YM strain were transferred to TSB medium at a ratio of 1:100, cultured with shaking at 200 r / min at 37°C, and the OD 600 When reaching 0.8, collect bacteria, wash three times with sterilized phosphate buffered saline (PBS), adjust its OD 600 to 1.0, counted by the plate method. Then press 10 times equidistant from 10 5 -10 9 After dilution of CFU, 12-day-old ducklings were inoculated by flipper injection, and the control group was injected with the same amount of sterilized phosphate buffered saline (PBS) in the same way. Each inoculated with 0.5mL, generally within 24 hours after inoculation, the...
Embodiment 3
[0082] Transcriptome sequencing analysis of RA-YM Cas9 gene deletion mutant strain
[0083] The RA-YMΔCas9 strain and the wild strain RA-YM were cultured on TSA medium, and the single colony was cultured in TSB medium at 37°C overnight, and then transferred to TSB medium at a ratio of 1:100, 37°C 200r / Min shaking culture, until its OD 600 When it reaches 0.8, collect the bacteria, extract RNA, and then send the RNA samples of RA-YMΔCas9 and RA-YM strains with qualified concentrations to Hengchuang Gene Technology Co., Ltd. for transcriptome sequencing.
[0084] The differentially expressed genes between the RA-YMΔCas9 strain and the parental strain RA-YM were analyzed by transcriptome sequencing. The results showed that there were 500 genes with 2-fold or more expression difference between the two, and 336 genes were up-regulated in the deletion strain. Further analysis found that there was an up-regulated lipoprotein gene (RAYM_RS04770) in the deletion strain, which has be...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap