Cathepsin B gene of bollworm and its clone, recombination and expression techniques
A technology of cathepsin and cotton bollworm, applied in the field of molecular biology and biology, can solve the problem that the function of protease needs to be further studied
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0033] Embodiment 1: a kind of cloned cotton bollworm cathepsin B cDNA gene has the following sequence:
[0034] (1) Information on SEQ ID NO 1
[0035] (a) Sequence features:
[0036] * Length: 1310 bp
[0037] *Type: nucleic acid
[0038] * Chain type: double chain
[0039] *Topology: Linear
[0040] (b) Molecular type: cDNA
[0041] (c) Assumption: No
[0042] (d) Antisense: no
[0043] (e) Original source: Cotton bollworm (Helicoverpa armigera)
[0044] (f)序列描述:SEQ ID NO.1GAAGACCACATCAGGGCTGAGTTATTTAAGAACGGCCCAGTTGAAGGTGCAGCTCAGTCG- 60TCGCGCCACATTCGCTCCGAATACACATCCATTAACCACTCAGCTGTGAAAAAGAAAATA-120AAGAAGTGAATAATGGCCGCTTCGCGTGCAACGTTTGTTGCGCTCGTGTGCGCTCTCGCG-180CTCGCCGCCGCCGATGTGCAGAATCCGCTCAGTGACGATTTCATCAATCTCATCAACACA-240AAGCAAAACTCTTGGAAAGCTGGTAGGAACTTCCCAGAGCACACGCCCTTCGCACACATC-300AAGAGATTAGCGGGTGTCCTGCCAGATTACCATTTGTCTAAATTAAGCAAAGTTGAACAT-360GAAGATGAATTGATTGCGAGTTTACCGGAGAACTTTGACCCGAGGGACAAATGGCCGAAC-420TGCCCTACTTTGAACGAAGTCAGGGACCAGGGATCTTGT...
Embodiment 2
[0053] Embodiment 2. Cloning method of cathepsin B cDNA gene of cotton bollworm
[0054] Cotton bollworm (Helicoverpa armigera), field collection or artificial rearing.
[0055] 1. Total RNA or mRNA extraction: use one-step method or RNA kit to extract total RNA or use mRNA kit to separate and extract mRNA
[0056] 2. cDNA first-strand synthesis: 5-10 micrograms of total RNA, plus 20 microliters of reaction solution (50 millimoles potassium chloride, 3 millimoles magnesium chloride), 10 millimoles tris-hydrochloric acid buffer (Tris -HCl) pH 8.3, 1 millimolar dithiothreitol (DTT), 5 micromolar oligodeoxythymonucleotide (Oligod(T) 17 ), 500 micromole deoxyribonucleotide mixture (dNTP), 25 units of RNase inhibitor, 8 units of AMV reverse transcriptase) were reacted at 42°C for 90 minutes. The reaction was terminated at 70°C for 10 minutes.
[0057] 3. PCR reaction: polymerase chain reaction (PCR) reagents and conditions:
[0058] First mix the following reagents together:
...
Embodiment 3
[0072] Embodiment 3. Expression method of cathepsin B cDNA gene of cotton bollworm
[0073] Expression primers:
[0074] Forward HCBpGEXF 5'AATAGAATTCATGGCCGCTTCGCG 3'
[0075] Reverse HCBpGEXR 5' TCGGCTCGAGCTAATATTCAACG 3'
[0076] The cathepsin B gene of the cotton bollworm is put into Escherichia coli or other prokaryotic organisms to express, and the active protease is obtained, which is used for medicine, health care, industrial production or insecticide.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com