Assay for detecting and quantifying HIV-1

Inactive Publication Date: 2006-03-30
GEN PROBE INC
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent is about a method for amplifying and detecting HIV-1 M group and O group nucleic acids in a single reaction. The method involves using two amplification primers and a hybridization probe. The primers can hybridize to different parts of the HIV-1 nucleic acids and the probe can detect the hybridization of the primers. The method can be used to quantify the amount of HIV-1 M group and O group nucleic acids in a biological sample. The technical effect of this invention is a more efficient and accurate method for detecting and quantifying HIV-1 M group and O group nucleic acids in a single reaction.

Problems solved by technology

Of the completely sequenced HIV-1 genomes, nearly 20% have a mosaic structure consisting of at least two subtypes, yet another potential complication for ultrasensitive HIV-1 detection assays.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Assay for detecting and quantifying HIV-1
  • Assay for detecting and quantifying HIV-1
  • Assay for detecting and quantifying HIV-1

Examples

Experimental program
Comparison scheme
Effect test

example 1

Time-Dependent Monitoring of HIV-1 M Group, Subtype B Amplicon Production

[0108] An in vitro synthesized transcript of known concentration included the sequence

(SEQ ID NO:29)GGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAG...

example 2

Different Kinetic Profiles Characterize Amplification of HIV-1 Variants

[0114] Amplification reactions were performed essentially as described under Example 1 with the following modifications. Parallel reactions were conducted using a first-strand promoter-primer having the target-hybridizing sequence of SEQ ID NO:13, a second-strand primer having the target-complementary sequence of SEQ ID NO:2, and variable amounts of either the subtype B template described in Example 1, or an O group template that included the sequence

(SEQ ID NO:32)AGTGGGTTCATAGAAGCAGAAGTGATACCAGCAGAAACAGGACAAGAAACTGCCTACTTCCTGTTAAAACTGGCTGCAAGATGGCCTGTTAAAGTAATACATACAGACAACGGGCCTAATTTTACAAGTACAACTATGAAGGCTGCATGTTGGTGGGCCAACATACAACATGAGTTTGGAATACCATATAATCCACAAAGTCAAGGAGTAGTAGAAGCCATGAATAAGGAATTAAAATCAATTATACAGCAGGTGAGGGACCAAGCAGAACACTTAAGAACAGCAGTACAAATGGCAGTATTTGTTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACACTGCAGGAGAAAGGATAATAGACATATTAGCATCACAAATACAAACAACAGAATTACAAAAACAAATTTTAAAANTTCACAAATTTCGGGTCTATTACAGAGACAGCAGAG...

example 3

Enhancement of Amplification Kinetics of HIV-1 O Group Templates

[0120] Parallel sets of amplification reactions were prepared to compare the effects of two different primer combinations on the kinetics of amplification of HIV-1 subtype B and HIV-1 O group templates. In each instance, a first-strand promoter-primer having the target-hybridizing sequence of SEQ ID NO:13 or SEQ ID NO:15 was used in combination with a second-strand primer having the target-complementary sequence of SEQ ID NO:2. Notably, the sequence of SEQ ID NO:15 differed from the sequence of SEQ ID NO:13 by the substitution of adenine for thymidine at position 15 in the target-hybridizing portion of the primer. This substitution corresponds to position 41 of the promoter-primers identified by SEQ ID NO:19 and SEQ ID NO:17. Amounts of HIV-1 templates used in the reactions ranged from 5 to 5×104 copies / reaction. Amplification reactions were prepared and monitored using materials and procedures essentially as described...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
timeaaaaaaaaaa
Tmaaaaaaaaaa
Tmaaaaaaaaaa
Login to View More

Abstract

Compositions, methods and kits for detecting HIV-1 nucleic acids using nucleic acid amplification. Particularly described are oligonucleotides that are useful as hybridization probes and amplification primers for detecting very low levels of HIV-1 nucleic acids by real-time monitoring of amplicon production. The invented assays are characterized by high levels of precision in the quantitation of HIV-1 targets at low copy numbers, and by accurate detection of different HIV-1 subtypes, including M group and O group variants.

Description

RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application Nos. 60 / 615,533, filed Sep. 30, 2004. The entire disclosure of this prior application is hereby incorporated by reference.FIELD OF THE INVENTION [0002] The present invention relates to the field of biotechnology. More specifically, the invention relates to diagnostic assays for detecting and quantifying the nucleic acids of HIV-1. BACKGROUND OF THE INVENTION [0003] Advances in the clinical management of individuals infected with the human immunodeficiency virus type 1 (HIV-1) have been able to reduce viral titers below the detection limits of some early-generation HIV-1 assays. More specifically, highly active anti-retroviral drug therapy (HAART) can reduce the viral load down to a level approaching 50 HIV-1 RNA copies / ml, a level substantially below the 400-500 copies / ml threshold of some previous detection assays. This fact, together with a desire to monitor and maintain low viral titer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/6851C12Q1/6865C12Q1/703C12Q2600/156C12Q2545/114C12Q2531/113
InventorSCHRODER, ASTRIDSAWYER, GLENNKOLK, DANIEL
OwnerGEN PROBE INC