Oncoprotein protein kinase

a technology of oncoprotein and kinase, which is applied in the direction of transferases, peptide/protein ingredients, instruments, etc., can solve the problems of overexpression of a particular gene, affecting healthy cells as well as neoplastic cells, and prone to act indiscriminately,

Inactive Publication Date: 2006-06-08
RGT UNIV OF CALIFORNIA
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a new protein kinase called JNK1 that phosphorylates the c-Jun N-terminal activation domain. JNK1 is a 46 kD serine and threonine kinase that specifically phosphorylates serine residues 63 and 73 of c-Jun. The discovery of JNK1 allows for the identification of compositions that affect JNK activity and the subsequent activation of genes associated with AP-1 sites. The invention also provides a method of treating a cell proliferative disorder associated with JNK by administering a therapeutically effective amount of a reagent that modulates JNK activity. The invention also provides a synthetic peptide that can inhibit the activation of c-Jun by JNK. Additionally, the invention describes a new protein kinase called JNK2 with similar activity to JNK1.

Problems solved by technology

In cells that have lost their growth regulatory mechanisms, it is believed that this Fos / Jun complex may “sit” on the AP-1 site, causing overexpression of a particular gene.
One problem with existing drug therapy is that it tends to act indiscriminately and affects healthy cells as well as neoplastic cells.
This is a major problem with many forms of chemotherapy where there are severe side effects primarily due to the action of toxic drugs on healthy cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oncoprotein protein kinase
  • Oncoprotein protein kinase
  • Oncoprotein protein kinase

Examples

Experimental program
Comparison scheme
Effect test

example 1

Plasmids and Expression of GST Fusion Proteins

[0097] The glutathione-S-transferase (GST)-cJun expression vector, pGEX2T-cJun(wt), was constructed by inserting a filled-in BspHI-PstI fragment (encoding AA 1-223) from RSV-cJun(BspHI) into the SmaI site of pGEX2T (Pharmacia). RSV-cJun(BspHI) was constructed by changing the translation initiation sequence CTATGA of RSV-cJun to TCATGA by site-directed mutagenesis. The GSTcJun(Ala63 / 67)(BspHI) expression vector was derived in the same manner from RSV-cJun(Ala63 / 73) (Smeal, et al., supra, 1991) and was used to construct pGEX2T-cJun(Ala 63 / 67). The various GSTcJun truncation mutants were constructed using the polymerase chain reaction (PCR) to amplify various portions of c-Jun coding region. The sequences of the primers are indicated below:

N-terminal primers:(SEQ ID NO: 2)TCTGCAGGATCCCCATGACTGCAAAGATGGAAACG (underlinedcodon: amino acid 1);(SEQ ID NO: 3)TCTGCAGGATCCCCGACGATGCCCTCAACGCCTC (a.a.11);(SEQ ID NO: 4)TCTGCAGGATCCCCGAGAGCGGACCTTA...

example 2

Kinase Assays

Solid Phase Kinase Assay

[0104] Cell extracts were diluted so that the final composition of the WCE buffer was 20 mM HEPES pH 7.7, 75 mM NaCl, 2.5 mM MgCl2, 0.1 mM EDTA, 0.05% Triton X-100, 0.5 mM DTT, 20 mM β-glycerolphosphate, 0.1 mM Na3VO4, 2 μg / ml leupeptin, 100 μg / ml PMSF. The extracts were mixed with 10 μl of GSH-agarose suspension (Sigma) to which 10 μg of either GST or GST-Jun fusion proteins were bound. The mixture was rotated at 4° C. for 3 hours in a microfuge tube and pelleted by centrifugation at 10,000×g for 20 sec. After 4×1 ml washes in HEPES binding buffer (20 mM HEPES pH 7.7, 50 mM NaCl. 2.5 mM MgCl2, 0.1 mM EDTA, 0.05% Triton X-100), the pelleted beads were resuspended in 30 μl of kinase buffer (20 mM HEPES pH 7.6, 20 mM MgCl2, 20 mM β-glycerolphosphate, 20 μM p-nitrophenyl phosphate, 0.1 mM Na3VO4, 2 mM DTT) containing 20 μM ATP and 5 μCl γ-32P-ATP. After 20 minutes at 30° C. the reaction was terminated by washing with HEPES binding buffer. Phospho...

example 3

Binding of a Protein Kinase to GST-cJun-GSH-Agarose Beads

[0106] The fusion protein, GSTcJun(wt), can bind through its GST moiety to glutathione (GSH)-agarose beads to generate an affinity matrix for identification of c-Jun binding proteins, which may include protein kinases. Ha-ras transformation of FR3T3 cells results in increased phosphorylation of c-Jun on Ser 63 and 73 (Binetruy, et al., supra, 1991; Smeal. et al., supra, 1991). Preliminary experiments indicated that transformed cells contained higher levels of c-Jun N-terminal kinase activity, while the levels of c-Jun C-terminal kinase activity remaned unchanged. To develop a more convenient assay for characterizing the c-Jun N-terminal kinase activity, nuclear and cytoplasmic extracts of untransformed and transformed FR3T3 cells were mixed with GSTcJun(wt)-GSH-agarose beads. FRT3T3(−) and Ha-ras-transformed FR3T3(+) cells were kept in 0.5% FCS for 24 hours and harvested to prepare nuclear and cytosolic extracts. These extrac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

Description

[0001] This application is a divisional of U.S. patent application Ser. No. 08 / 799,913, filed Feb. 13, 1997, now U.S. Pat. No. 5,804,399, which is a continuation of Ser. No. 08 / 444,393, filed May 19, 1995, now U.S. Pat. No. 5,605,808, which is a divisional of U.S. patent application Ser. No. 08 / 276,860, filed Jul. 18, 1994, now U.S. Pat. No. 5,593,884, which is a continuation-in-part application of U.S. patent application Ser. No. 08 / 220,602, filed Mar. 25, 1994, which is a continuation-in-part of U.S. patent application Ser. No. 08 / 094,533, filed Jul. 19, 1993.[0002] This invention was made with support by Howard Hughes Medical Institute and Government support under Grant No. DE-86ER60429, awarded by the Department of Energy and Grant No. CA-50528 and CA-58396, awarded by the National Institute of Health. The Government has certain rights in this invention. Also supported by the Howard Hughes Medical Institute.BACKGROUND OF THE INVENTION [0003] 1. Field of the Invention [0004] This...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68C12Q1/48A61K38/00C07K16/40C12N9/12C12N15/54
CPCA61K38/00C07K16/40C12N9/12C12N9/1205C12Q1/485C12Q1/6897G01N2333/9121G01N2500/04Y10S435/81Y10S435/975
InventorKARIN, MICHAELHIBI, MASAHIKOLIN, ANNING
OwnerRGT UNIV OF CALIFORNIA