Compositions and methods of using a synthetic dnase i

a technology of synthetic dnase and bovine dnase, which is applied in the field of polydeoxyribonucleic acid hydrolase, can solve the problems of unsuitability at low concentrations of enzymes and substrates, and achieve the effects of promoting tight binding by the enzyme, lowering the km of the enzyme for dsdna, and high vmax values

Inactive Publication Date: 2011-12-29
APPL BIOSYSTEMS INC
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011]The present invention includes a synthetic bovine DNase I (sbDNase I) mutant that was designed, developed and discovered to exhibit several desirable properties as compared to wild-type DNase I. For example, variants of sbDNase I described herein have an up to 20-fold lower Km than wild-type DNase I. The enzyme of the present invention is also salt-tolerant, that is, it maintains at least 30% of peak activity from 0-200 mM NaCl, whereas the wild-type enzyme does so only from 0˜40 mM. Thus, sbDNase I is a versatile enzyme that can be added directly to most molecular biology buffers without a significant loss in activity. Importantly, the salt tolerance of sbDNase I can be “ratcheted” up or down by altering the Ca2+ concentration; thereby providing a molecular switch that can be used to turn the enzyme on and off by either adding a divalent cation (like calcium) or removing the cations using, e.g., EDTA, EGTA or other chelating agent. Furthermore, when manufactured in a non-mammalian expression system, sbDNase I is ˜107-fold less contaminated with RNase activity than bovine pancreas. For example, it has been found that ≧20 U sbDNase I failed to degrade significantly a radiolabeled RNA transcript, whereas, the wild-type enzyme causes obvious degradation of said probe at above 10 U. When expressed in a non-mammalian expression system the ease of production is improved, costs are reduced and the need for mammalian tissue culture systems eliminated.
[0012]The sbDNase I of the present invention is a versatile enzyme that cleaves DNA nonspecifically to release 5′-phosphorylated di-, tri-, and oligonucleotide products. The sbDNase I may be used for a wide range of molecular biology applications, including: degradation of contaminating DNA after RNA isolation; “clean-up” of RNA prior to RT-PCR and after in vitro transcription; removal of DNA prior to protein sample loading on 2-D gels; identification of protein binding sequences on DNA (DNase I footprinting); prevention of clumping when handling cultured cells; and creation of a fragmented library of DNA sequences for in vitro recombination reactions.

Problems solved by technology

One problem with wild-type DNase I is its modest Km (˜600 nM) for model dsDNA substrates, which makes it unsuitable at low concentrations of enzyme and substrate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods of using a synthetic dnase i
  • Compositions and methods of using a synthetic dnase i
  • Compositions and methods of using a synthetic dnase i

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0065]Expression of a Synthetic Bovine DNase I in E. coli. DNase I is an extremely toxic protein in E. coli. Inasmuch as this enzyme readily degrades dsDNA, active DNase I in the cytoplasm will cleave bacterial chromosomal DNA and kill the cell. In fact, an effective concentration of DNase I for clearing DNA contamination in advance of RT-PCR (−2.5 nM) is approximately the same as that of a single DNase I molecule in an E. coli cell (assuming a cell volume of ˜1 fL). As a result, non-conventional strategies must be considered to successfully express this protein in reasonably high yield (>5 mg / L).

[0066]The coding portion of the gene for the synthetic bovine DNase I (sbDNase I) was created by assembling oligodeoxynucleotides that were synthesized de novo (FIG. 1). For common molecular biology and protein expression manipulations, procedures were performed as described in Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press) or Current Protocols in Molecular Biology (J. Wi...

example 2

[0079]Purification of sbDNase I from E. coli. The chromatographic strategy used to purify sbDNase I was based in part by that described by Chen et al. (Protein Science 2002; 11:659-668). Binding of sbDNase I to an anion exchange resin is mediated by its calcium binding properties. In addition to having several weak calcium binding sites, sbDNase I has two strong binding sites that bind with a micromolar Kd. A steric shift to binding free calcium and subsequent conformational change is likely to cause DNase to elute at low calcium concentrations (reportedly 7 mM), although the sbDNase I protein described herein elutes at a higher calcium concentration. Soluble sbDNase I collected from induced BL21(DE3) culture fluid was concentrated and dialyzed, in their case, by an ultrafiltration cell and purified by anion exchange. The sbDNase I activity was loaded onto the column in low ionic strength buffer (20 mM Tris pH 7.5), and eluted using a shallow CaCl2 gradient (0-15 mM).

[0080]The sbDNa...

example 3

[0082]Expression of sbDNase I in P. pastoris. The sbDNase I gene was cloned into the pPICZαA expression vector (Invitrogen), which is a shuttle vector containing the Zeocin resistance marker and yeast alpha-mating factor secretion signal sequence. The following primers were designed using NotI and XhoI restriction sites for insertion into the pPicZalpha plasmid:

sbDNase I sequencepPICZsbDNase-Forward(SEQ ID NO.: 13)       XhoI      L  K  I A  A  F  N  IATCCGCTCGAGAAGAGACTGAAGATCGCAGCTTTCAACATCpPICZsbDNase-Reverse(SEQ ID NO.: 14)         NotI  Stop T  L  T  V  E  VATAAGAATGCGGCCGCTTAAGTCAGGGTCACCTCAACCG

[0083]PAGE-purified primers were used to PCR amplify an ˜800 bp fragment from pET-22b_sbDNase I. This ˜800 bp fragment (˜700 ng) was gel-purified, and digested with 50 U Not I and 20 U Xho I overnight. The pPicZαA vector (1.2 ug) was similarly digested. Both double-digested samples were then gel purified. FIGS. 3A and 3B show the nucleic and amino acid sequences, respectively, of the al...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions and method for making and using a synthetic bovine DNase I are disclosed. More particularly, the sbDNase I of the present invention is a versatile enzyme that cleaves DNA nonspecifically to release 5′-phosphorylated nucleotides. The sbDNase I molecules of the present invention find particular use in a wide range of molecular biology applications, including: degradation of contaminating DNA after RNA isolation; RNA clean-up prior to, or in conjunction with, RT-PCR after in vitro transcription; identification of protein binding sequences on DNA (DNase I footprinting); prevention of clumping when handling cultured cells; tissue dissociation and creation of fragmented DNA for in vitro recombination reactions.

Description

[0001]This invention was made with government support under R44CA69967 awarded by the National Cancer Institute. The government may own certain rights in the invention. Without limiting the scope of the invention, its background is described in connection with polydeoxyribonucleic acid hydrolases, as an example.TECHNICAL FIELD OF THE INVENTION[0002]The present invention relates in general to the field of polydeoxyribonucleic acid hydrolases, and more particularly, to compositions and methods of using a synthetic bovine DNase I.BACKGROUND OF THE INVENTION[0003]Deoxyribonuclease (DNase) is a phosphodiesterase capable of hydrolyzing polydeoxyribonucleic acid into individual 3′ or 5′-phosphate deoxynucleotides on hydrolysis of deoxyribonucleic acid (DNA). Based on their biochemical properties and enzymatic activities, DNase proteins have been classified as two types, DNase I and DNase II. DNase I proteins have a pH optimum near neutral and an obligatory requirement for divalent cations,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N9/22C07H21/04C12NC12N1/00C12P19/34C12Q1/68
CPCC12N9/22
InventorLATHAM, GARYKEMPPAINEN, JON
OwnerAPPL BIOSYSTEMS INC