Multiplexed Analysis Of Polymorphic Loci By Concurrent Interrogation And Enzyme-Medicated Detection

a polymorphic locus and multi-layered technology, applied in the field of molecular diagnostics and genetic typing or profiling, can solve the problems of high cost, low sample throughput, and high complexity, and achieve the effect of reducing the degree of degeneracy

Inactive Publication Date: 2012-08-23
BIOARRAY SOLUTIONS
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention provides methods and probes for the concurrent interrogation of multiple polymorphic sites in a target nucleotide sequence without interference from non-designated sites. The methods involve annealing a set of probes to the target sequence and allowing them to form hybridization complexes with the designated polymorphic sites. The probes can be extended using enzymatic recognition, which allows for the discrimination of polymorphisms even in a multiplexed format. The methods can be performed with a single label detection and can incorporate complexity in the probe design. The invention also provides a method for identifying polymorphisms at designated sites in a target polynucleotide sequence by assigning a value to each site while accommodating non-designated sites. The methods can be used in a multiplexed elongation assay or in a multiplexed elongation assay with temperature control. The invention also provides sets of probes for the concurrent interrogation of polymorphic sites and methods for the concurrent interrogation of nucleotide composition at designated polymorphic sites."

Problems solved by technology

The multiplexed analysis of polymorphisms while desirable in facilitating the analysis of a high volume of patient samples, faces a considerable level of complexity which will likely increase as new polymorphisms, genetic markers and mutations are identified and must be included in the analysis.
As further discussed herein below, while providing reasonable detection in a research laboratory setting, these methods require significant labor, provide only slow turnaround, offer only low sample throughput, and hence require a high cost per sample.
However, the spotted arrays of current methods exhibit not only significant array-to-array variability but also significant spot-to-spot variability, an aspect that leads to limitations in assay reliability and sensitivity.
In addition, spotted arrays are difficult to miniaturize beyond their current spot dimensions of typically 100 μm diameter on 500 μm centers, thereby increasing total sample volumes and contributing to slow assay kinetics limiting the performance of hybridization assays whose completion on spotted arrays may require as much as 18 hours.
The complexity of array fabrication, however, limits routine customization and combines considerable expense with lack of flexibility for diagnostic applications.
On the other hand, the correspondingly high degree of immunogenetic polymorphism represents significant difficulties in allotransplantation, with a mismatch in HLA loci representing one of the main causes of allograft rejection.
However, the requirement of the SSP methods of the prior art for extensive gel electrophoretic analysis for individual detection of amplicons represents a significant impediment to the implementation of multiplexed assay formats that can achieve high throughput.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplexed Analysis Of Polymorphic Loci By Concurrent Interrogation And Enzyme-Medicated Detection
  • Multiplexed Analysis Of Polymorphic Loci By Concurrent Interrogation And Enzyme-Medicated Detection
  • Multiplexed Analysis Of Polymorphic Loci By Concurrent Interrogation And Enzyme-Medicated Detection

Examples

Experimental program
Comparison scheme
Effect test

example 1

Staggered Probe Design for Multiplexed SSP Analysis

[0138]Probes for each polymorphism are immobilized on a solid phase carrier to provide a format in which multiple concurrent annealing and extension reactions can proceed with minimal mutual interference. Specifically, this method provides a design which accommodates overlapping probes, as illustrated in FIG. 1. In this example, we consider three alleles: allele A, allele B and allele C. Probes 1 and 2 detect SNPs that are aligned with their respective 3′ termini while probes 3 and 4 detect two-nucleotide polymorphisms that are aligned with their respective 3′ termini. The polymorphic sites targeted by probes 1 and 2 are located five nucleotides upstream of those targeted by probes 3 and 4. This design permits each probe to bind its corresponding target and permits elongation to proceed when there is a perfect match at the designated polymorphic site. Thus, probes 1 and 3 match allele A, probe 2 and possibly probe 3 match allele B, ...

example 2

Probe Design for HLA Typing

[0139]To design probes for the analysis of the polymorphic region ranging from base 106 to base 125 of the DRB gene, twenty-two different types of sequences for the 20 base long fragment were located in the DRB database. These are listed in the table below:

7DRB1*0101TTCTTGTGGCAGCTTAAGTT104DRB1*03011TTCTTGGAGTACTCTACGTC26DRB1*04011TTCTTGGAGCAGGTTAAACA1DRB1*0434TTCTTGGAGCAGGTTAAACC3DRB1*07011TTCCTGTGGCAGGGTAAGTA1DRB1*07012TTCCTGTGGCAGGGTAAATA28DRB1*0801TTCTTGGAGTACTCTACGGG1DRB1*0814TTCTTGGAGTACTCTAGGGG1DRB1*0820TTCTTGGAGTACTCTACGGC1DRB1*0821TTCTTGGAGTACTCTATGGG1DRB1*09012TTCTTGAAGCAGGATAAGTT2DRB1*10011TTCTTGGAGGAGGTTAAGTT1DRB1*1122TTCTTGGAGCAGGCTACACA1DRB1*1130TTCTTGGAGTTCCTTAAGTC18DRB1*15011TTCCTGTGGCAGCCTAAGAG9DRB3*01011TTCTTGGAGCTGCGTAAGTC1DRB3*0102TTCTTGGAGCTGTGTAAGTC1DRB3*0104TTCTCGGAGCTGCGTAAGTC16DRB3*0201TTCTTGGAGCTGCTTAAGTC1DRB3*0212TTCTTGCAGCTGCTTAAGTC6DRB4*01011TTCTTGGAGCAGGCTAAGTG14DRB5*01011TTCTTGCAGCAGGATAAGTA

[0140]The first column contains the ...

example 3

Utilizing Mismatch Tolerance To Modify Allele Binding Patterns

[0147]Probe DR-13e, GGACATCCTGGAAGACGA, was used to target the bases 281-299 of the DRB gene. Thirty-four alleles, including allele DRB1*0103, are perfectly matched to this sequence. Thus, in the binding pattern, 13e is positive for theses 34 alleles (that is, 13e will yield elongation products with these 34 alleles). Several additional alleles display the same TEI region but display non-designated polymorphisms in their respective annealing regions. For example, five alleles, such as DRB1*0415, contain T in instead of A in position 4 while four alleles, such as DRB 1*1136, contain C in the that position. Due to mismatch tolerance in the annealing region, target sequences complementary to these nine alleles will produce elongation reaction patterns similar to that of the perfectly matched sequence. The result is shown in FIGS. 2. TO-3 and TO-4 are completely complementary sequences to allele *0415 and *1136, respectively....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
DAaaaaaaaaaa
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides methods and processes for the identification of polymorphisms at one or more designated sites, without interference from non-designated sites located within proximity of such designated sites. Probes are provided capable of interrogation of such designated sites in order to determine the composition of each such designated site. By the methods of this invention, one or more mutations within the CFTR gene and the HLA gene complex can be identified.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority from U.S. Provisional Application Ser. No. 60 / 329,427 filed Oct. 14, 2001, U.S. Provisional Application Ser. No. 60 / 329,620, filed Oct. 15, 2001, U.S. Provisional Application Ser. No. 60 / 329,428, filed Oct. 14, 2001 and U.S. Provisional Application Ser. No. 60 / 329,619 filed Oct. 15, 2001. This application is related to PCT application Serial Number PCT / US02 / ______ of the same title filed concurrently herewith. All the above-referenced applications are expressly incorporated herein by reference.FIELD OF THE INVENTION[0002]The present invention generally relates to molecular diagnostics and genetic typing or profiling. The invention relates to methods, processes and probes for the multiplexed analysis of highly polymorphic genes. The invention also relates to the molecular typing and profiling of the Human Leukocyte Antigen (HLA) gene complex and the Cystic Fibrosis Conductance Trans-membrane Regulator gene ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C40B30/04C07H21/04C12N15/09C12P19/34
CPCC12Q1/6827C12Q1/6837C12Q1/6858C12Q1/6883C12Q2600/16C12Q2600/156C12Q2565/537C12Q2535/125C12Q2527/107A61P9/00C12Q2531/113
InventorLI, ALICE XIANGHASHMI, GHAZALASEUL, MICHAEL
OwnerBIOARRAY SOLUTIONS