Unlock instant, AI-driven research and patent intelligence for your innovation.

Solid support assay systems and methods utilizing non-standard bases

A non-standard, base technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as increased non-specific hybridization

Inactive Publication Date: 2008-04-30
LUMINEX
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When two components of similar sequences hybridize to each other, as described above, many allelic sequences, especially those containing SNPs, will increase non-specific hybridization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Solid support assay systems and methods utilizing non-standard bases
  • Solid support assay systems and methods utilizing non-standard bases
  • Solid support assay systems and methods utilizing non-standard bases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0149] Cross-hybridization detection of coding and marker sequences

[0150] Instruments used in this analysis included the Luminex 100 and Luminex Microbeads, DNA synthesizer (Northern Engineering Company), spectrophotometer for point measurement synthesis field, thin-layer chromatography column (TLC) (SI250F TLC silica gel plate, JTBaker), qualitative control for oligonucleotides, centrifuge , Sonicator (Ney Dental), Vortex (Vortex) and various pipettes (2, 20, 200 and 1000 μl)

[0151] A set of at least 100 oligonucleotide strands (molecular recognition sequences) and their complements (tag sequences) are designed and synthesized. These two sets of oligonucleotides contain non-standard nucleotides (isoC and isoG) (EraGen Biosciences, Inc., Madison, WI) and natural nucleotides (A, G, C and T) (Perkin-Elmer / ABI) , 9 to 10 bp long. The 5' end of the first set of oligonucleotide strands designed as molecular recognition sequences was labeled with an amino modifier (C6-TFA...

Embodiment 2

[0170] Preliminary determination of the role of non-standard bases in predicting nucleic acid duplex stability parameters

[0171] This experiment uses a Beckman DU-7500 spectrometer with temperature control system and sample holder. The precise temperature control system can measure the temperature of six samples at the same time. The quartz cups are Hellma products from the United States. In order to cover a range of one hundred times the sample concentration, the optical path lengths are 0.1cm, 0.2cm, 0.5cm, and 1.0cm. DNA was synthesized on a DNA synthesizer model 392 of Perkin-Elmer / ABI Company. Liquid tank (Fisher) for TLC chromatography, TLC plate (Si250F, JT Baker). Sanvant SpeedVac was used to prepare DNA, and Sep-pakC-18 purification column (Waters), UV lamp, vortex shaker, 100cc syringe, and several micropipettes (2, 20, 200, 1000 μl) were also used.

[0172] Oligonucleotides were synthesized using natural nucleotides (A, G, C and T) (Perkin-Elmer / ABI) and isoC...

Embodiment 3

[0197] Embodiment 3 and comparative examples thereof

[0198] site-controlled incorporation

[0199] First Primer 5' AGAACCCTTTTCCTCTTCC (SEQ ID NO: 104) Target Sequence 5' AAGAACCCTTTCCTCTCCGATGCAGGATACTTAACAATAAATATTT (SEQ ID NO: 105)

[0200] Second primer CTACGTCCTATGAATTGTTATTTATAAAYAGGACAGACG5' (SEQ ID NO: 106)

[0201] Y=isoCTP

[0202] The first primer and its target sequence and the second primer are shown in SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106, respectively.

[0203] PCR experiments were performed with the following mixture: 0.2 μM first primer, 0.2 μ / M second primer, 50 fM target sequence, dGTP, dATP, dTTP and dCTP, 50 μM each, 10 mM TrispH8, 0.1% BSA, 0.1 % Triton X-100, 0.1 μg / μl degraded salmon sperm DNA, 40 mM KAc, 2 mM MgCl 2 , 1 U Amplitaq Stoffel (Perkin Elmer Biosciences, Foster City, CA). The mixture was first incubated at 95°C for 2 minutes, then cycled at 95°C for 1 second and 58°C for 10 seconds, and 30 PCR cycles were set. The final...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Solid support assays using non-standard bases are described. A capture oligonucleotide comprising a molecular recognition sequence is attached to a solid support and hybridized with a target oligonucleotide the solid support. In some instances, the molecular recognition sequence includes one or more non-standard bases and hybridizes to a complementary tagging sequence of the target oligonucleotide. In other instances, incorpoaration of a non-standard base (e.g., via PCR or ligation) is used in the assay.

Description

Background of the invention [0001] For oligonucleotides, including DNA and RNA fragments, a variety of different analytical methods have been developed, which can often directly detect whether a sample contains oligonucleotides with specific target oligonucleotide sequences. Nucleotides. In some cases, for many allelic sequences, the oligonucleotide sequences differ by only a few nucleotides. Single nucleotide polymorphisms (SNPs) refer to allelic differences in a single nucleotide. At least in some cases, even a single nucleotide difference can cause a corresponding change in genetic response or trait. Accordingly, in order to detect which alleles are present in a sample, the detection technique must be sensitive enough to distinguish closely related sequences. [0002] Many analytical techniques involve multiple components, each of which will hybridize to the others in the analytical test. Non-specific hybridization (ie, hybridization of two non-complementary sequences) ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor J·K·格雷尼尔D·J·马沙尔J·R·普鲁登特C·S·里奇蒙E·B·雷施C·W·舍雷尔C·B·舍里尔J·L·普塔钦
Owner LUMINEX