Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use

A technology of glucagon and genetically engineered bacteria, applied in the field of bioengineering, can solve the problems of high price, high synthesis cost, difficult polypeptide technology, etc.

Inactive Publication Date: 2008-06-04
EAST CHINA NORMAL UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The preparation of glucagon-like peptide-1 in foreign countries mostly adopts chemical synthesis, but chemically synthesized peptides are technically difficult, costly to synthesize, and difficult to purify
The products prepared by this method are expensive and not suitable for China's national conditions. Therefore, it is urgent to develop a localized high-efficiency and low-cost human glucagon-like peptide-1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use
  • High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use
  • High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Construction of a genetically engineered bacterium expressing human glucagon-like peptide-1: a genetically engineered bacterium containing 1 to 16 single strings of SD-TrxA-His·Tag-EK-GLP-1-TAA. The TrxA is thioredoxin.

[0052] The first step of base sequence synthesis

[0053] According to the sequence: SD sequence-purification tag His·Tag-enterokinase EK site-human glucagon-like peptide-1, that is, GLP-1 gene-stop codon TAA, chemically synthesized base sequence with a length of 215bp, as follows ,

[0054] XbaI SD sequence

[0055] 5'-CC tctaga AATAATTTTGTTTAACTTTAAG AAGGAGA TATACATATGTCTGGA

[0056] Met Ser Gly

[0057] His·Tag BglII

[0058] TCAGGT CATCATCATCATCATCAT TCTTCT agatct GATGACGACGACAAG

[0059] Ser Gly His His His His His His His Ser Ser Gly Thr Asp Asp Asp Asp Lys

[0060] EK

[0061] CATGCCGAAGGCACCTTTACCAG...

Embodiment 2

[0072] Example 2 Construction of a genetically engineered bacterium expressing human glucagon-like peptide-1: containing 1 to 16 single strings of P T7 - Genetically engineered bacteria of SD-His·Tag-EK-GLP-1-TAA.

[0073] The first step of base sequence synthesis

[0074] With the first step of embodiment 1;

[0075] The second step is to construct a genetically engineered bacterium containing the DNA sequence of a single string of GLP-1 genes

[0076] The DNA sequence of the single string of GLP-1 gene is P T7 -SD-His·Tag-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 obtained in the first step by double digestion with two restriction endonucleases, the two restriction endonucleases The enzymes are XbaI and EcoRI, the small fragments are purified and recovered, the plasmid pET-32a(+) is double-digested with the same two restriction enzymes, the large fragments are purified and recovered, and the small fragments and large fragments recovered above are connected to obt...

Embodiment 3

[0079] Example 3 Construction of a genetically engineered bacterium expressing human glucagon-like peptide-1: containing 1 to 16 single strings of P T7 - Genetically engineered bacteria of SD-TrxA-His·Tag-EK-GLP-1-TAA.

[0080] The first step of base sequence synthesis

[0081] With the first step of embodiment 1;

[0082] The second step constructs the genetically engineered bacterium containing the DNA sequence of the single string GLP-1 gene

[0083] The DNA sequence of the single string of GLP-1 gene is P T7 -SD-His·Tag-TrxA-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 obtained in the first step by double digestion with two restriction endonucleases, the two restriction endonucleases The endonuclease is KpnI / EcoRI, the small fragment is purified and recovered, the plasmid pET-32a(+) is double-digested with the same two restriction endonucleases, the large fragment is purified and recovered, and the small and large fragments recovered above are connected to obtain...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of biological engineering technology. The gene engineering bacteria is colibacillus DH5-alpha, BL21(DE3) or BLR(DE3) carrying the recombinant plasmid of human glicentin-1 gene, i. e., GLP-1 gene. The construction process of the gene engineering bacteria includes connecting serially DNA sequence containing human glicentin-1 gene to form polymer, constituting expression vector and converting to colibacillus to obtain efficiently expressing human glicentin-1 gene engineering bacteria. With the gene engineering bacteria and through a three-step process of liquid culture, purification to produce human glicentin-1 fusion protein and preparation of human glicentin-1, human glicentin-1 product may be produced. The present invention has the advantages of high expression amount, less purification steps, high yield and low production cost.

Description

technical field [0001] The invention relates to a genetically engineered bacterium expressing human glucagon-like peptide-1, its construction method and application, and belongs to the technical field of bioengineering. Background technique [0002] Diabetes is a worldwide disease with a high incidence rate and poses a serious threat to human health. According to the latest report of the International Diabetes Institute (IDI) in 2003, there are 194 million people with diabetes worldwide. According to the current growth rate, by 2025, the number of patients will reach 333 million. There are more than 40 million diabetic patients in my country. In the early 1980s, the incidence rate of diabetes in my country was only 0.67%. Now the incidence rate in Beijing, Shanghai and other places has exceeded 10%, and this number is still increasing. According to statistics, the annual cost of treatment for ordinary diabetic patients is 3,726 yuan, while diabetic patients need to take med...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/12C12N15/66C07H21/00C12P21/02
Inventor 黄静吴自荣左翼徐进楼旻徐伟东
Owner EAST CHINA NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com