Unlock instant, AI-driven research and patent intelligence for your innovation.

Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand

An endostatin, small molecule polypeptide technology, applied in the direction of peptide sources, animal/human peptides, peptide/protein components, etc., can solve the problem that endostatin has a large molecular weight, can only be used for intramuscular and subcutaneous injection, and is unsafe dosage. And other issues

Active Publication Date: 2008-10-22
HARBIN MEDICAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The purpose of the present invention is to solve the defects of the existing endostatin with large molecular weight, which can only be used for intramuscular and subcutaneous injection, unsafe intravenous administration and large dosage, and provide a small molecule polypeptide of endostatin and the encoding of the polypeptide Nucleotide sequence and complementary strand

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand
  • Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand
  • Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0005] Specific embodiment 1: The amino acid sequence of the endostatin small molecule polypeptide in this embodiment is as follows:

[0006] MetHisSerHisArgAspPheGlnProValLeuHisLeuValAlaLeuAsnSerProLeuSerGlyGlyMetArgGlyAspArgGlyAsp.

[0007] The endostatin small-molecule polypeptide (endostatin) of this embodiment has high antitumor activity, which is 2 to 3 times that of other existing endostatins, and the tumor inhibition rate in animal in vivo tumor inhibition experiments is increased by more than 11 percentage points. In this embodiment, the molecular weight of the endostatin small molecular polypeptide (endostatin) is only one-sixth of that of endostatin, which is easier to absorb and improves the safety of medication; while maintaining the activity of endostatin to indirectly limit tumor growth by inhibiting angiogenesis At the same time, it can also directly inhibit the growth and metastasis of tumor cells, improve the anti-tumor activity, and reduce the dosage of drug...

specific Embodiment approach 2

[0017] Specific embodiment two: the nucleotide sequence encoding endostatin small molecule polypeptide in this embodiment is as follows:

[0018] ATGCACAGCACCGTGACTTCCAGCCTGTTCTCCACCTGGTTGCTCTCAACAGCCCTCTGTCAGGTGGTATGCGTGGTGACCGTGGTGAC.

[0019] In this embodiment, the nucleotide sequence encoding the endostatin small molecule polypeptide is designed according to the preference of Escherichia coli for the code, and the nucleotide sequence encoding the endostatin small molecule polypeptide is transformed into the bioengineering bacteria Escherichia coli BL21(DE3 ) can be stably and accurately transcribed and translated into endostatin small molecule polypeptide (endostatin).

specific Embodiment approach 3

[0020] Specific embodiment three: The nucleotide sequence of the complementary strand of the endostatin small molecule polypeptide nucleotide sequence in this embodiment is as follows:

[0021]GTCACCACGGTCACCACGCATACCACCTGACAGAGGGCTGTTGAGAGCAACCAGGTGGAGAACAGGCTGGAAGTCACGGTGGCTGTGC.

[0022] In this embodiment, the 3' end of the complementary chain nucleotide sequence lacks two bases complementary to AT at the 5' end of the endostatin small molecule polypeptide nucleotide sequence. The two chains are annealed after phosphorylation, and one end is a sticky end with two more bases of AT, and the other end is a blunt end, which is conducive to recombination with the plasmid vector pTYB after digestion with Nde I and Sma I.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

This invention relates to endostatin small molecular polypeptide, its coding nucleotide sequence and complementary strand. The endostatin small molecular polypeptide has 30 amino acid residues corresponding to a nucleotide sequence with a full length of 90 bp and a complementary strand with a length of 88 bp. The endostatin small molecular polypeptide avoids the defects of the current endostatin such as high molecular weight, limit to subcutaneous injection and intramuscular injection, large dosage and unsafety in intravenous injection. The endostatin small molecular polypeptide has such advantages as low molecular weight and no medicine accumulation, and is suitable for intravenous, intramuscular and subcutaneous injection. The coding nucleotide sequence and complementary strand can be synthesized by an automatic synthesizer, and used to manufacture endistatin in large scale by genetic engineering after recombination and transformation.

Description

technical field [0001] The present invention relates to a small molecule polypeptide, a nucleotide sequence and a complementary chain encoding the polypeptide. Background technique [0002] By inhibiting the formation of new blood vessels in tumor tissue, cutting off the nutrient supply of tumor cells and forcing tumor cells to stop growing or even die is a new focus of tumor drug therapy. Endostatin is currently recognized internationally as the most active inhibitor of angiogenesis. The American gene recombinant human endostatin has completed phase III clinical trials, and the test results have confirmed that endostatin can significantly inhibit a variety of tumors. ,Therapeutic effect. Endostatin has attracted much attention because of its broad anti-tumor spectrum, low toxicity and no drug resistance. However, the endostatin currently produced is more than 180 amino acids, which is not suitable for intravenous injection and can only be used for intramuscular and subcut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/62A61K38/17A61P35/00
Inventor 刘兴汉赵炜明林雪松
Owner HARBIN MEDICAL UNIVERSITY