Bifidobacteria-bacillus coli shuttle expression vector, preparation method and application thereof

A technology of shuttle expression vector and bifidobacteria, applied in the field of genetic engineering, can solve the problems of single source of shuttle vector, influence on plasmid stability and influence, etc., and achieve the effects of good biological safety, increased stability and good application prospect.

Active Publication Date: 2013-02-27
北京爱施凯健康管理发展有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As for the curative effect of endostatin gene-transformed bifidobacterium preparations on lung cancer reported by Liu Wenhua et al. in 2001 [9] Study on the killing effect of B16-F10 mouse melanoma cells expressed by Bifidobacterium infantis expressing recombinant cytosine deaminase gene reported by Ren Qiwei and others in 2004 [10] , the plasmids are Escherichia coli plasmid pBV220 and pGEX-1LambdaT respectively, and their replication elements are the replication sequence of pBR322, with poor stability
Although the replication sequence of pMB1 comes from Bifidobacterium, the stability of the plasmid is greatly improved, but the replication initiation site of the replication sequence of pMB1 is deleted [8] , so that the regulation of plasmid replication is affected, and the stability of the plasmid is affected to a certain extent
Moreover, in the above-mentioned reports, except for the pMB1 recombinant vector constructed by Hou Xin et al. using the hu promoter of Bifidobacterium, the rest of the vectors were all made of LacZ of Escherichia coli or its derivative sequence Tac [such as pGEX series vectors]. It can only be expressed under the regulation of IPTG (Isopropyl-beta-D-thiogalactopyranoside, isopropyl-B-D thiogalactopyranoside), and IPTG has certain toxicity, which largely limits its use in gene therapy and oral vaccine development Applications
[0005] Overall, the construction and optimal screening of Escherichia coli-Bifidobacteria shuttle vectors are still the weakness and focus of the research and development of bifidobacteria genetic engineering. The transformation efficiency still needs to be improved, and the stability is also lacking; moreover, the source of the current shuttle vector is single, and it is necessary to use new ideas and basic elements to construct a more efficient and stable shuttle vector, providing new vector tools for the field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bifidobacteria-bacillus coli shuttle expression vector, preparation method and application thereof
  • Bifidobacteria-bacillus coli shuttle expression vector, preparation method and application thereof
  • Bifidobacteria-bacillus coli shuttle expression vector, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction of Bifidobacterium-Escherichia coli shuttle expression vector of the present invention

[0036] 1. replace the Ptac promoter (183-932) on the pGEX-5x-1 with the promoter AmyO (position: 599-690nt) of the α-amylase (amylase) gene (GenBank No: AY240946) of bifidobacteria, and simultaneously The LacIq fragment (position: 3301-4420nt) on pGEX-5x-1 was deleted by PCR method.

[0037] Specific steps are as follows:

[0038] 1. Use BamHI and SacII enzymes to cut 110 base pairs of the α-amylase gene AmyO (promoter) sequence synthesized by Shanghai Bioengineering Technology Co., Ltd., and add the M13 reverse sequencing primer sequence (taaaacgacggccagt) to its 5' end ( SEQ ID NO.6) for sequencing.

[0039] Its construction route is as follows:

[0040] (1) The promoter sequence of the bifidobacterium alpha-amylase gene: 599 ta aaataaacag catacgttcgcaatagtgca aacgctatca aagaagatga acccccgtta aagggattga agaaaaggaa taaaggagcc690 (SEQ ID NO.7);

[0041] (2...

Embodiment 2

[0065] Example 2 Using the bifidobacterium Escherichia coli shuttle expression vector of the present invention to construct engineering bacteria expressing the LTB gene

[0066] In this example, the heat-labile enterotoxin B subunit (abbreviated as LTB) gene (GenBank No: M17874; Position: 79-391nt) is connected to the bifidobacterium Escherichia coli shuttle expression vector pBEX prepared in Example 1 to construct the shuttle vector pBEX-LTB expressing the LTB gene (see attached Figure 11 ). Apparently, the Bifidobacterium Escherichia coli shuttle expression vector pBEX prepared in Example 1 can also be used for the expression of all foreign genes and the production of genetic engineering products with Bifidobacteria as recipient bacteria.

[0067] 1. The steps of using the Bifidobacterium-Escherichia coli shuttle expression vector of the present invention to construct an engineering bacterium expressing the LTB gene are as follows

[0068] (1) The ETEC LTB gene was amplif...

Embodiment 3

[0078] Example 3 Use Bifidobacterium-ETEC LTB recombinant bacteria of the present invention to prepare an oral live vaccine and verify the efficacy of the vaccine

[0079] 1. The Bifidobacterium-ETEC LTB recombinant bacterium prepared in Example 2 is made into lactic acid fermentation preparation, tablet and capsule preparation Bifidobacterium-ETEC LTB recombinant carrier oral live vaccine, used for prevention and treatment of diarrheal diseases caused by ETEC . It can also be used as a mucosal immune adjuvant for all oral vaccines.

[0080] 2. Validation of efficacy of oral live vaccines

[0081] 1) Test grouping (30 20-day-old male Kunming rats were randomly divided into the following 3 groups):

[0082] Vaccine immunization group, Bifidobacterium control group without recombinant vector and PBS control group.

[0083] 2) Kunming rat gavage immune test (4.0×10 9 Bacteria / only):

[0084] Bifidobacteria control group without recombinant vector: gavage with bifidobacteria ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bifidobacterium-escherichia coli shuttle expression vector, the preparation method and the usage, which pertains to the field of genetic engineering. The technical problem to be solved by the invention is to provide a new high-efficient and safe bifidobacterium-escherichia coli shuttle expression vector which has the stable expression. The bifidobacterium-escherichia coli shuttle expression vector of the invention takes a pGEX-5x-1 plasmid as a skeleton, a promoter Ptac on the pGEX-5x-1 is replaced by the promoter AmyO of an Alpha-amylase gene of the bifidobacterium, and the invention further contains the replication protein B sequence of a KJ36 plasmid of bifidobacterium longum. The bifidobacterium-escherichia coli shuttle expression vector of the invention can be widely applicable to the expression of all foreign genes which take the bifidobacterium as the receptor bacteria and the production of genetic engineering products, thereby providing a new vector toll for the related application of the field and having great application prospect.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a bifidobacterium-Escherichia coli shuttle expression vector, a preparation method and application thereof. Background technique [0002] Relatively little research has been done on bifidobacterial plasmids. In 1982, Sgortati etc. carried out the detection of plasmids to 1461 bifidobacteria of 24 species in total, and found that the bifidobacteria of four species (20% of the total number of strains) were Bifidobacterium longum, Bifidobacterium globosa, Bifidobacterium bifidobacterium and Bifidobacterium indica contain plasmids. There are only 16 records of Bifidobacterium plasmids retrieved in GenBank [NC006843, NC004978, NC004770, NC004769, NC004768, NC004253, NC004252, NC00443, NC004943, NC002635, NC002133, NC0035257, X115149, E180D95] but no One is a vector that can be directly used for exogenous gene expression. Due to the rarity of bifidobacterium plasmids i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N15/74C12N15/31C12N1/21A61K39/108A61K39/39A61P31/04C12R1/19C12R1/01
Inventor马永平
Owner北京爱施凯健康管理发展有限公司