Novel function of c-Jun participating in classical Wnt signal transduction path
A c-jun and signaling technology, applied in the field of cell biology, can solve problems such as unclear transcription
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1c
[0095] Obtaining of embodiment 1c-Jun
[0096]The inventors used a protein consisting of amino acids 1-375 (called Dvl1-N7) of the Dvl1 protein (see SEQ ID NO: 2) as a "bait" to screen a 10.5-day mouse embryo bank by yeast two-hybrid ( Invitrogen). The two-hybrid system used was ProQuest TM Two-Hybrid System (purchased from Invitrogen), for specific experimental methods, see the instruction manual provided by the two-hybrid system. As a result, a c-Jun clone with deletion of 73 amino acids at the N-terminal was obtained.
Embodiment 2
[0097] Example 2c-Jun and Dvl protein interaction
[0098] 1. c-Jun can interact with three Dvl proteins in cells
[0099] For further research, the inventors designed primers at both ends of the human c-Jun gene and introduced XhoI and NotI restriction sites at the N-terminus and C-terminus respectively. The primers are:
[0100] Forward: CTAGCTCGAGGACTGCAAAGATGGAAAC (SEQ ID NO: 8)
[0101] Reverse: ATAAGAATGCGGCCGCTCAAAATGTTTGCAACT (SEQ ID NO: 9)
[0102] Using the human cDNA library prepared by conventional methods as a template, the sequence containing the full-length c-Jun was obtained by PCR reaction, and then double-digested with XhoI / NotI, and the digested products were respectively cloned into the XhoI of the pCMV vector (purchased from Bioscience) In the / NotI restriction site and in the SalI / NotI restriction site of pET28c, plasmids pCMV / c-Jun and pET28c / c-Jun, which can be expressed in eukaryotic cells and prokaryotic cells, respectively, were constructed.
[01...
Embodiment 3
[0120] The function of embodiment 3c-Jun in canonical Wnt signal transduction pathway
[0121] Mainly use the Topflash reporter gene activity system to detect.
[0122] The Topflash reporter gene comes from Upstate Company; the activity detection of the reporter gene uses: Luciferase Reporter Gene Assay, High Sensitivity, from Roche Company, and the detection method can be found in the instruction manual provided at the same time. According to the sequence of c-Jun, the siRNA sequence against c-Jun was designed as follows: 5'-GUCAUGAACCACGUUAACA dTdT-3' (SEQ ID NO: 10), which can be directly transfected.
[0123]Human embryonic kidney cell 293T cells and colon cancer cell SW480 cells (purchased from ATCC, which is a colon cancer cell line with APC protein function loss) were transfected with the above-mentioned reporter gene containing luciferase promoter region with Tcf binding site , green fluorescent protein, c-Jun small interfering RNA (siJun). After about 48 hours of tr...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com