Avian origin promoter expression vector, construction method and use thereof
The technology of a vector and an expression cassette, which is applied to the avian-derived promoter expression vector and its construction and application fields, can solve the problems of cumbersome steps, low connection efficiency and high cost, and achieve the effect of simple process and ideal efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1, construction of pAPP-Vector
[0026] 1) Construction of pA
[0027] Design primers pA Vector1 upstream and pA Vector1 downstream, pA Vector2 upstream and pA Vector2 downstream, the sequences of primers pA Vector1 upstream and pA Vector1 downstream, pA Vector2 upstream and pA Vector2 downstream are as follows:
[0028] Upstream of pA Vector1: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG 3';
[0029] Downstream of pA Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.
[0030] Upstream of pA Vector2: 5'CTCGAGGATATCTGCA GATATC CAGCACAC 3' (the underlined part is the EcoR V enzyme recognition site);
[0031] Downstream of pA Vector2: 5' CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.
[0032] Using the pEGFP-N1 (Invitrogen) plasmid as a template, use primers pA Vector1 upstream and pA Vector1 downstream to PCR amplify fragment A; use pCDNA3.0 plasmid as a template, use primers pA Vector2 upstream and pA Vector2 downstream to PCR amplify fragment B.
[0033] PCR reaction system: 5 μL of ...
Embodiment 2
[0060] Example 2, the ability of pAPP-vector to express protein
[0061] 1) Construction of pAPP-EGFP-Vector expressing green fluorescent protein
[0062] Design primers EGFP upstream and EGFP downstream, the primer sequences are as follows:
[0063] EGFP upstream: GGAATTCTGCAGATTCGCCACCATGGTGAG;
[0064] Downstream of EGFP: ATGCATGCTCGAGGATTTACTTGTACAGCTCG.
[0065] The GGAATTCTGCAGAT and ATGCATGCTCGAGGAT sequences in the primers are sequences capable of homologous recombination with the nucleotide sequence at positions 695-710 at the 5' end of sequence 1 and the nucleotide sequence at positions 711-726 at the 5' end of sequence 1 .
[0066] Using pEGFP-N1 as a template, the EGFP gene fragment was amplified by PCR with primers EGFP upstream and EGFP downstream.
[0067] Reaction system: 5 μL of 10×PCR Buffer, 1 μL of upstream and downstream primers, 1 μL of DNA template, MgCl 2 (25mM) 3μL, dNTPs (2.5mM each) 3μL, Pfu-Taq (5U / μL) 0.5μL, and finally add water to 50μL.
[...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 