Supercharge Your Innovation With Domain-Expert AI Agents!

Method for producing Buthus martensii Karsch toxin AGAP

A production method, the SUMO-AGAP technology, is applied in the field of medicine and biology to achieve the effects of increasing yield, saving costs, and easy operation

Inactive Publication Date: 2011-01-26
JIANGSU PROVINCE INST OF TRADITIONAL CHINESE MEDICINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether the SUMO expression system can be used for the production of AGAP has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing Buthus martensii Karsch toxin AGAP
  • Method for producing Buthus martensii Karsch toxin AGAP
  • Method for producing Buthus martensii Karsch toxin AGAP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Preparation of recombinant scorpion venom protein AGAP

[0034] 1) Construction of SUMO-AGAP fusion gene by overlapping PCR technique

[0035]According to the SUMO gene sequence (Genebank no.U27233.1) and AGAP gene sequence (Gene bank no.AF464898.1) found in the NCBI database, primers were designed as follows:

[0036] P1: 5'CGATATA CCATGGGTCATCACCATTCATCACGGGTCGGACTCAG3'

[0037] P2: 5'CAATATAACCATCGCGTACACCTCCAATCTGTTCGCGGTG 3'

[0038] P3: 5' GGAGGT GTACGCGATGGTTATATTG 3'

[0039] P4: 5'AGAACTCTCGAGCTAACCGCCATTGCATTTTCC3'

[0040] Among them, P1 contains the NcoI restriction site, start code, His6 tag and SUMO upstream complementary sequence, P2 contains the downstream SUMO complementary sequence and AGAP upstream complementary sequence, P3 contains the upstream complementary sequence of AGAP, P2 and P3 contain complementary regions, and P4 contains AGAP downstream complementary sequence and BamH I restriction site and stop codon.

[0041] In the f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of medical biology, and particularly relates to a production method for recombining scorpion toxin protein AGAP. The method comprises the following steps: firstly, obtaining SUMO-AGAP fusion genes with His6 labels by using overlapping PCR technology; secondly, constructing a recombinant expression vector containing the SUMO-AGAP fusion genes; thirdly, transferring the constructed expression vector to a host cell to express; and finally, cracking the cell by using a physical method or a chemical agent, extracting recombinant fusion protein and His purified fusion protein to obtain pure SUMO-AGAP fusion protein, carrying out enzyme cutting reaction, releasing AGAP, and further purifying the fusion protein to obtain the purified AGAP protein. The method greatly improves the yield, saves the cost, and is simple and convenient to operate; and the AGAP produced by the method has broad biologic activity, can restrain the proliferation of various tumor cells, and simultaneously has analgesia effect.

Description

technical field [0001] The invention belongs to the field of medical biotechnology, in particular, relates to a method for preparing a large amount of recombinant scorpion venom protein AGAP with high biological activity in prokaryotic cells, especially E. Biological activity, can inhibit the proliferation of a variety of tumor cells, and has an analgesic effect. Background technique [0002] In traditional Chinese medicine, scorpions are an important source of medicine. In the medical history of our country, scorpion was used as medicine very early. With the development of science and technology, studies have found that scorpion venom is the main active substance of the traditional medicinal material scorpion, which exists in the poison sac of the tail of the scorpion and is discharged from the needle when stabbed. Scorpion venom is a biological toxin second only to snake venom in toxicity. A complex mixture of ingredients. Its main active ingredients are toxic proteins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12P21/02C12R1/19
Inventor 曹鹏卢悟广王志刚于杰淼
Owner JIANGSU PROVINCE INST OF TRADITIONAL CHINESE MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More