Unlock instant, AI-driven research and patent intelligence for your innovation.

Purpose of hsa-miR-150

A kind of use, tumor technology, applied in the field of hsa-miR-150

Inactive Publication Date: 2010-08-11
SHANGHAI BIOCHIP
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There is no research report on the relationship between hsa-miR-150 and gastric cancer differentiation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Purpose of hsa-miR-150
  • Purpose of hsa-miR-150
  • Purpose of hsa-miR-150

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 miRNA microarray assay to detect differentially expressed miRNAs in gastric cancer tissues

[0029] 1. Preparation of Clinical Samples

[0030] Gastric cancer surgical resection specimens, 26 pairs of gastric cancer and adjacent normal tissues were collected, frozen at -80°C, and transported in liquid nitrogen. Clinicopathological information showed that the 26 gastric cancer tissues included poorly differentiated, moderately differentiated, and moderately or poorly differentiated gastric cancer tissues. The diagnostic criteria for gastric cancer refer to the unified criteria for pathological diagnosis of gastric mucosal biopsy developed by the National Gastric Cancer Pathology Cooperative Group.

[0031] 2. Extraction, quality detection and purification of total RNA

[0032] (1) Frozen section

[0033] 26 pairs of gastric cancer and its adjacent normal tissues were examined by HE staining, cut into 5-6 slices at 8 μm, and stored in 1.5ml centrifuge tubes a...

Embodiment 2

[0046] Example 2 Detection of hsa-miR-150 expression changes by real-time quantitative PCR

[0047] (1) Internal reference setting and primer design and synthesis

[0048] U6-2 was selected as the internal reference, and the quantitative PCR primers for miRNA consisted of specific primers and universal primers, among which the universal primers were qiagen miScript SYBR The Green PCR kit comes with it; the specific primer sequence is TCTCCCAACCCTTGTACCAG (SEQ ID NO: 2), synthesized by our company.

[0049] (2) RNA extraction and reverse transcription cDNA synthesis

[0050] The extraction, quality detection and purification steps of RNA are as described in Example 1.

[0051] For reverse transcription, miScript reverse transcription kit (Qiagen) was used. 5×RT buffer, reverse transcriptase mixture, template RNA, and RNase-free water were added to a PCR tube, mixed gently, and placed on ice.

[0052] The reverse transcription PCR reaction program is: 37°C for 60 minutes; th...

Embodiment 3

[0056] Example 3 Screening of Drugs Inducing Tumor Differentiation

[0057] Taking hsa-miR-150 of the sequence shown in SEQ ID NO: 1 as a target, a drug for inducing tumor differentiation is designed and screened. The specific method is as follows.

[0058] A system expressing hsa-miR-150 is treated with a candidate substance, and then the expression level of hsa-miR-150 in the system is detected. If the candidate substance can reduce the expression of hsa-miR-150, it indicates that the candidate substance is a potential drug capable of inducing tumor differentiation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the purpose of hsa-miR-150 in preparing products for helping doctors diagnose the malignancy degrees of tumors, and the purpose of the hsa-miR-150 in preparing or screening medicaments for inducing the differentiation of the tumors. The hsa-miR-150 relevant to the differentiation of gastric cancers can be used as a marker for helping doctors diagnose the malignancy degrees of the tumors and a marker for predicting the survival rates of patients with the tumors, and simultaneously can also be used as a medicament target for treating the gastric cancers or other tumors.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to the application of hsa-miR-150 related to gastric cancer differentiation. Background technique [0002] Gastric cancer is one of the most common malignant tumors in the world. According to the sampling survey of malignant tumor deaths in China from 1990 to 1992, the death rate of gastric cancer was close to 25.2 / 100,000 (male 32.8 / 100,000, female 17.0 / 100,000). , accounting for 23.2% of tumor patients who died in 1990-1992, ranking first among all kinds of malignant tumors. Although the mortality rate of gastric cancer has decreased significantly in recent years, it is still very high. Most gastric cancer patients are confirmed by gastroscopy and biopsy after discovering clinical symptoms such as abdominal discomfort, dull pain, pantothenic acid, gas or weight loss, and melena. , mostly late, missed the best period of treatment. [0003] Screening methods for gastric can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68A61K48/00A61P35/00
Inventor 张庆华阳圣杨燕青张雯
Owner SHANGHAI BIOCHIP