Purpose of hsa-miR-150
A kind of use, tumor technology, applied in the field of hsa-miR-150
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 miRNA microarray assay to detect differentially expressed miRNAs in gastric cancer tissues
[0029] 1. Preparation of Clinical Samples
[0030] Gastric cancer surgical resection specimens, 26 pairs of gastric cancer and adjacent normal tissues were collected, frozen at -80°C, and transported in liquid nitrogen. Clinicopathological information showed that the 26 gastric cancer tissues included poorly differentiated, moderately differentiated, and moderately or poorly differentiated gastric cancer tissues. The diagnostic criteria for gastric cancer refer to the unified criteria for pathological diagnosis of gastric mucosal biopsy developed by the National Gastric Cancer Pathology Cooperative Group.
[0031] 2. Extraction, quality detection and purification of total RNA
[0032] (1) Frozen section
[0033] 26 pairs of gastric cancer and its adjacent normal tissues were examined by HE staining, cut into 5-6 slices at 8 μm, and stored in 1.5ml centrifuge tubes a...
Embodiment 2
[0046] Example 2 Detection of hsa-miR-150 expression changes by real-time quantitative PCR
[0047] (1) Internal reference setting and primer design and synthesis
[0048] U6-2 was selected as the internal reference, and the quantitative PCR primers for miRNA consisted of specific primers and universal primers, among which the universal primers were qiagen miScript SYBR The Green PCR kit comes with it; the specific primer sequence is TCTCCCAACCCTTGTACCAG (SEQ ID NO: 2), synthesized by our company.
[0049] (2) RNA extraction and reverse transcription cDNA synthesis
[0050] The extraction, quality detection and purification steps of RNA are as described in Example 1.
[0051] For reverse transcription, miScript reverse transcription kit (Qiagen) was used. 5×RT buffer, reverse transcriptase mixture, template RNA, and RNase-free water were added to a PCR tube, mixed gently, and placed on ice.
[0052] The reverse transcription PCR reaction program is: 37°C for 60 minutes; th...
Embodiment 3
[0056] Example 3 Screening of Drugs Inducing Tumor Differentiation
[0057] Taking hsa-miR-150 of the sequence shown in SEQ ID NO: 1 as a target, a drug for inducing tumor differentiation is designed and screened. The specific method is as follows.
[0058] A system expressing hsa-miR-150 is treated with a candidate substance, and then the expression level of hsa-miR-150 in the system is detected. If the candidate substance can reduce the expression of hsa-miR-150, it indicates that the candidate substance is a potential drug capable of inducing tumor differentiation.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 