Check patentability & draft patents in minutes with Patsnap Eureka AI!

Analogue of glucagon like peptide-1

A technology of glucagon and analogues, which is applied in the field of peptide analogues, can solve the problems of high price, complicated purification process, pollution, etc., and achieve the effect of maintaining the hypoglycemic time, definite hypoglycemic effect, and prolonging the half-life

Inactive Publication Date: 2014-02-26
吴晓琰 +2
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

3. Because Exendin 4 has a longer peptide chain, its stimulation of the pancreas may be related to pancreatitis
4. Production: Exendin 4 analogue Exenatide, which is now on the market, is a fully synthetic product, expensive, GLP-1 400$ / mg, Exendin4 up to 700$ / mg
The chemical synthesis of GLP-1 and Exendin 4 will cause a series of problems: low yield, high price, complicated purification process, residual impurities, and environmental pollution caused by organic solvents and chemicals used in the production process
4. Novo Nordisk’s Liraglutide is a long-acting fatty acid acylation product of GLP-1. It only needs to be used once a day, but the DPPIV enzyme site still exists, and the hypoglycemic effect is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Analogue of glucagon like peptide-1
  • Analogue of glucagon like peptide-1
  • Analogue of glucagon like peptide-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Production of GLP-1 Analogs by Genetic Engineering

[0027] Material

[0028] GLP-1 analog

[0029] EcoRI Bgl II Arg His Gly Gly Glu Gly Thr Phe Ile Ser Asp Val Ser Ser Tyr Leu

[0030] CGT CAC GGC GGC GAA GGC ACC TTC ATC AGC GAT GTT AGC AGC TAC CTG

[0031] Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Gln Gly Pro Pro Arg

[0032] GAA GGC CAG GCG GCG AAA GAA TTC ATC GCG TGG CTG GTT CAG GGC CCG CCG CGT

[0033] GGATCC TAG

[0034] BamH I Sal I

[0035] (1) According to the amino acid sequence of the GLP-1 analogue and the corresponding DNA (positive strand) sequence, synthesize a DNA fragment:

[0036] 5′ GGAATTCCAGATCTCGTCACGGCGGCGAAGGCACCTTCACCAGCGATCTGAGCAGCTACCTGGAAGGCCAGGCGGCGAAAGAGTTCATCGCGTGGCTGGTTAACGGCCCGCCGCGTGGATCCTAGGTCGAC 3′

[0037] The primers designed are as follows:

[0038] C05A-1 CCAATGGAATTCCAGATCTCGTCACGGC

[0039] C05A-2 TGAAGGTGCCTTCGCCGCCGTGACGAGATCTGG

[0040] C05A-3 GGCGAAGGCACCTTCACCAGCGATCTGAGCAG

[0041] C05A-4 CCTGGCCTTCC...

Embodiment 2

[0051] Preparation of GLP-1 analogs

[0052] (A) GLP-1 analogue genetically engineered bacteria were inoculated in 300ml×2 bottles of LB medium, and Ampicillin was added to make the final concentration 50 μg / ml, cultured on a shaking table at 37°C overnight (150rpm). On the second day, transfer to a 20L New Brunswik fermenter for cultivation, the composition of the culture medium is M9 culture medium, the concentration of glucose is 1%, the concentration of ampicillin is 50μg / ml, the ventilation rate is 20L / min, and the dissolved oxygen is maintained at 20%. Above, the anti-foaming agent is domestic foam enemy, and the pH is maintained at 7-8, adjusted with ammonia water. When the cell concentration reaches the midline of the log curve, add IPTG at a concentration of 0.5 mM, continue fermentation for 4 to 6 hours, and collect the cells by centrifugation to obtain a wet weight of 30 to 50 g / L.

[0053] (B) Homogenize the collected bacteria with pH 7.0 Tris buffer 20mM, then ad...

Embodiment 3

[0059] Preparation of Derivatives of Myristic Acylated GLP-1 Analogs

[0060] (A) Dissolve 10 g of the fusion protein of GLP-1 analogues in 100 ml of water, add guanidine hydrochloride to make the final concentration 5 M, and incubate at 45° C. overnight.

[0061] (B) Weigh 1.14g of myristic acid (Maristic acid), 0.6g of N-hydroxysuccinimide (N-hydroxysuccinimide), and 1.03g of N,N'-dicyclohexylcarboximide (DCCI) in 50ml In dioxane (dioxane), stir at room temperature, after 4 hours, filter to remove urea derivatives, take 20ml of clear liquid and add to (A), add 100μl tetramethylguanidine (Tetrameltyl-guanidine), and react under vigorous stirring at room temperature After 4 hours, adjust the pH to 3-4 with 2N HCl, centrifuge at 8000 rpm, wash the precipitate twice with ethanol, dissolve the fatty acid acylated GLP-1 analog in water, adjust the pH to 7-8 with sodium bicarbonate powder, press Add high-purity porcine trypsin to 1-2‰ of the weight and stir at 37°C for 2-3 hours, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an analogue of glucagon like peptide-1(GLP-1), a medicinal composition comprising the GLP-1 analogue and a polypeptide (1-33) medicament. Compared with natural GLP-1, the polypeptide has the effect of reducing blood sugar, can be used for treating type 2 diabetes, can resist hydrolysis of DPPIV enzyme, can prolong action time and has a structure close to that of human-derived GLP-1 because three kinds of amino acid are added at one end of C and a structure at one end of N is changed into His-Gly(1-2). The invention also provides a medicinal composition comprising the polypeptide, which is produced through chemical synthesis and recombinant DNA. According to a gene engineering technique and a process for producing the polypeptide on a large scale, cost can be reduced and a new treatment medicament is provided for patients suffering from the type 2 diabetes.

Description

technical field [0001] The present invention relates to a polypeptide of the analogue of glucagon-like peptide-1 (GLP-1). The polypeptide has the effect of lowering blood sugar and can be used for treating type 2 diabetes. The invention also provides methods for producing these polypeptides by chemical synthesis and recombinant DNA production techniques. Background technique [0002] Diabetes has become the third major chronic disease that seriously endangers human health after cardiovascular and cerebrovascular diseases and tumors. With the improvement of people's living standards, the incidence of diabetes has increased year by year and has evolved into a worldwide outbreak of epidemic diseases, and has a tendency to expand and rejuvenate. As the course of the disease progresses, patients may experience various complications, such as blindness, renal failure, limb gangrene, cardiovascular disease, and cerebrovascular accident. There are an estimated 20.8 million people w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/605A61K38/26A61P3/10
Inventor 吴晓琰孙玉琨
Owner 吴晓琰
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More