Embedded tissue-specific expressed Cre tool mice built by utilizing Flp-Frt system

A flp-frt, cd4-stop-cre technology, applied in the biological field, can solve the problems such as not many Cre transgenic tool mice, incomplete tissue-specific promoters, affecting expression, etc.

Inactive Publication Date: 2012-03-14
NANJING UNIV SCI PARK DEV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the tissue specificity of the Cre transgene is mainly determined by the choice of the transgenic promoter, and the research on the tissue-specific promoter is not yet complete, at present, there are not many truly tissue-specific Cre transgenic tool mice.
Many tissue-specific Cre tool mice have the problem of "expression leakage", that is, expression in unwanted tissues or time
At the same time, the random insertion of the transgene and the DNA sequence around the insertion site will also affect the expression of tissue-specific Cre tools

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Embedded tissue-specific expressed Cre tool mice built by utilizing Flp-Frt system
  • Embedded tissue-specific expressed Cre tool mice built by utilizing Flp-Frt system
  • Embedded tissue-specific expressed Cre tool mice built by utilizing Flp-Frt system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0044] One, the construction of the tool vector pBS-Pr-Flp of eukaryotic expression Flp recombinase (flow process sees Figure 4 ), including the following steps:

[0045] Step 1, with Flp-ER (129S4 / SvJaeSor-Gt (ROSA) 26Sor tm1(FLP1)Dym / J, stock No.003946, Jackson Laboratory) mouse genome DNA was used as a template, and the Flp fragment was amplified by PCR. Primers are: FlpF:CG GGATCCGCCGCC ATGGGGATGCCACAATTTGATATATTATG; FlpR:CG ACGCGT TTATATGCGTCTATTTATGTAGG. The underlined part is the restriction site introduced by PCR. The PCR product was connected to pMD18-T and identified by enzyme digestion. The clone with the correct enzyme digestion identification result was sent to Jinsite Technology (Nanjing) Co., Ltd. for sequencing to confirm the correctness. After the Flp fragment was ligated from pMD18T with restriction endonucleases BamHI and MluI, the Flp fragment was substituted for the Cre fragment in the pBS185 plasmid (Gibico), and the digestion was verified to be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Traditional Cre transgene has difficultly in carrying out tissue-specific expression. The invention carries out innovation based on a double transgenic technique and a Flp-Frt technique. The invention is characterized in that: firstly, an STOP original part is added in front of a translation initiation codon of Cre to inhibit the expression of downstream Cre, and two Frt sequences are separately added to the upstream and downstream of the STOP original part; then the STOP original part between the two Frt sequences can be specifically deleted by utilizing Flp recombinase, thus the downstream Cre recombinase can be expressed at the moment; and tissue-specific promoters are added in front of the expression plasmids of Cre and Flp, thus the tissue Cre which is expressed in both the promoters can be expressed. The invention has the beneficial effects that: improvement and innovation are carried out on a traditional building method of a tissue-specific Cre transgenic carrier; and the correct tissue specificity and time specificity of Cre are calibrated by utilizing an intersection of two specific promoters, thus promoting the research on gene function utilizing conditional gene knockout mice and further being applied to research of medical and pharmaceutical targets.

Description

technical field [0001] The invention relates to the establishment of a new nested tissue-specific Cre tool mouse, in particular to a new technology for establishing a nested tissue-specific expression Cre tool mouse by utilizing the Flp-Frt system and double transgenic technology, and belongs to the field of biotechnology . Background technique [0002] Conditional gene knockout technology is an important means to study gene function and further apply to medical research. Tissue-specific expression of Cre transgenic mice is an important tool for conditional gene knockout technology and is widely used in scientific research and medical research. Cre recombinase was discovered by Sternberg in P1 phage in 1981. The gene has 1029 bases (Gene ID: 2777477), encodes a protein with a size of about 38K, belongs to the λInt enzyme superfamily (integrase superfamily), and is a site-specific recombinase that can recognize partially palindromic loxP sequences (5'-ATAACTTCGTATA-ATGTATG...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/64A01K67/027
Inventor徐静悦唐安康迪高翔
OwnerNANJING UNIV SCI PARK DEV