Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof

A technology of genetically modified soybeans and detection kits, applied in the field of molecular biology, to achieve the effects of simple operation, high sensitivity, and easy identification

Active Publication Date: 2013-08-21
广州迪澳生物科技有限公司 +2
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009]Loop-Mediated Isothermal Amplification (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene developed by Eiken Chemical Co., Ltd. in Japan around 2000 Amplification technology, which has the advantages of fast, simple, accurate operation, easy popularization, safety and reliability. At present, there is no kit that applies the LAMP method to the rapid detection of transgenic soybean DP-305423 and its derivatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof
  • LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof
  • LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Kit containing chromogen and detection method thereof:

[0056] LAMP detection kit for transgenic soybean DP-305423 and its derivatives, including primer solution, reaction solution, DNA polymerase, control and color reagent:

[0057] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0058] Outer primer 1: CAAAAAGAGAACACGGGTA (SEQ ID No: 1)

[0059] Outer primer 2: GTATGAGGTGGTGAAGGC (SEQ ID No: 2)

[0060] Internal primer 1: GTGTGAATAAGCAATGTTGGGATCAAGTGGACATACGTGA (SEQ ID No: 3)

[0061] Inner primer 2: AACTAAGAAAGTCTTCCATAGCGAGAAAGAGAAAGAAGATGGT (SEQ ID No: 4)

[0062] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0063] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0064] (4) Control: The positive control is the DNA of transgenic soybean DP-3...

Embodiment 2

[0072] Embodiment 2 The kit and detection method thereof without chromogenic agent:

[0073] The kit is the same as that in Example 1 except that it lacks the chromogen in Example 1.

[0074] Use the above kit to detect the soybean variety to be tested in the following way:

[0075] (1) DNA extraction of the sample to be tested: the DNA of the sample to be tested is extracted and purified by the CTAB method;

[0076] (2) Constant temperature gene amplification reaction: prepare reaction system in 200ul PCR tube: primer solution 1μl, reaction solution 12.5μl, DNA polymerase 1μl, DNA to be tested 2μl, make up to 25μl with sterilized deionized water; set positive control During the reaction, replace the DNA to be tested with the DNA of transgenic soybean DP-305423 at a concentration of 5% or E. coli plasmid DNA containing the target gene. When setting a negative control reaction, replace the DNA to be tested with a reaction mixture that does not contain the target gene; Mix the...

Embodiment 3

[0080] Embodiment 3 PCR reaction and the comparison of detection method sensitivity of the present invention:

[0081] Prepare the LAMP detection kit of transgenic soybean DP-305423 and its derivative varieties according to the following formula:

[0082] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0083] Outer primer 1: CAAAAAGAGAACACGGGTA (SEQ ID No: 1)

[0084] Outer primer 2: GTATGAGGTGGTGAAGGC (SEQ ID No: 2)

[0085] Internal primer 1: GTGTGAATAAGCAATGTTGGGATCAAGTGGACATACGTGA (SEQ ID No: 3)

[0086] Inner primer 2: AACTAAGAAAGTCTTCCATAGCGAGAAAGAGAAAGAAGATGGT (SEQ ID No: 4)

[0087] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0088] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0089] (4) Control: The positive control is the DNA of transgenic soybean ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof. The detection primer group comprises four specific primers. The detection kit comprises a primer solution, a reaction solution, DNA (deoxyribonucleic acid) polymerase, controls and a color developing agent. The detection method is characterized by comprising the following steps: extracting the DNA of the soybean variety to be detected, adopting the four specific primers and the DNA polymerase with strand displacement activity to amplify the sample DNA template at 63-65 DEG C, adding SYBRGreenI to observe color change or observing change of turbidity of the precipitates in a reaction tube with a turbidity meter to judge whether the sample DNA template is amplified and determining whether the soybean variety to be detected contains or is the transgenic soybean DP-305423 and derived varieties thereof, wherein the short-time amplification efficiency can reach 109-1010 copies. The detection primer group, kit and method disclosed by the invention have the advantages of quickness, efficiency, simpleness and convenience in operation and identification, high specificity, high sensitivity, suitability for field detection and the like and are suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method of a transgenic plant variety, in particular to a LAMP detection primer set, a detection kit and a detection method of the transgenic soybean DP-305423 and its derivative varieties. Background technique [0002] soybeans ( Glycine max ) is a leguminous plant whose seeds are rich in protein. Its country of origin is China, and it has been planted for 5,000 years. Since 1996, China has begun to import soybeans in large quantities, and the import volume is equivalent to my country's soybean production. China imports soybeans mainly from the United States, Argentina and Brazil. All three countries are major producers of GM soybeans. Among them, genetically modified soybeans imported from the United States accounted for 89% of the total imports. [0003] DP-305423 soybean was developed by DuPont. The introduced exogenous genes are gm-fad2-1 gene fragment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 唐大运张隽高苏娟范耀森肖艳文石磊
Owner 广州迪澳生物科技有限公司