Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Humanized monoclonal antibody against dec-205 molecule on the surface of dendritic cells

A technology of DEC-205 and dendritic cells, which is applied in the field of cellular immunology and molecular biology, to achieve the effect of enhancing the presentation efficiency and strengthening the immune response

Active Publication Date: 2019-01-29
INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The antibodies produced by this method are non-human antibodies. If they are used as drugs in the human body, they will have a strong rejection reaction, so they must be humanized.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized monoclonal antibody against dec-205 molecule on the surface of dendritic cells
  • Humanized monoclonal antibody against dec-205 molecule on the surface of dendritic cells
  • Humanized monoclonal antibody against dec-205 molecule on the surface of dendritic cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0025] The preparation process of the humanized monoclonal antibody against DEC-205 molecules on the surface of dendritic cells according to the embodiment of the present invention includes the following steps:

[0026] 1. Preparation of immune antigen

[0027] The primers were designed to amplify the N-terminal SP, Fn, CR regions and the C-terminal transmembrane and intracellular regions of DEC-205 molecule, respectively. The two fragments were connected by overlap PCR and inserted into the expression vector pCDNA3.1. Insertion site: XbalI, EcoRI. The amplification primers are:

[0028] DEC11: TGCTCTAGAGCCACCATGAGGACAGGCTGG,

[0029] DEC12: TATCCTCCCTCGGAGGGAGGCTTTAAGCAGATGCC,

[0030] DEC21: CTCCCTCCGAGGGAGGATACACAGCAATAGCTATC,

[0031] DEC22: CTCCCTCCGAGGGAGGATACACAGCAATAGCTATC.

[0032] The expression vector was transfected into YB2 / 0 cell line, and the stable expression cell line DEC1 was selected by G418, and the cell expression results were detected by flow cytometry. Such as f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a humanized monoclonal antibody for resisting DEC-205 molecules on surface of dendritic cells. A complementary determining region (CDR) in a heavy chain variable area has the following sequence: CDR1: SEQIDNO3 in a sequence table; CDR2: SEQIDNO4 in the sequence table; and CDR3: SEQIDNO5 in the sequence table; the complementary determining region (CDR) in a light chain variable area has the following sequence: CDR1: SEQIDNO6 in the sequence table; CDR2: SEQIDNO7 in the sequence table; and CDR3: SEQIDNO8 in the sequence table. The humanized monoclonal antibody has the beneficial effects that antigen material can be conveyed to the surface of an antigen presenting cell efficiently and specifically by taking the antibody as a carrier, so that the antigen presenting cell can carry out endocytosis, process and presenting on the antigen, and the presenting efficiency of the antigen presenting cell can be improved, and the immunoreaction of the organism to the antigen is strengthened. The antibody taken as the carrier has potential application prospect in various diseases with the characteristic of low immunoreaction.

Description

Technical field [0001] The invention belongs to the fields of cellular immunology and molecular biology, and specifically relates to a humanized monoclonal antibody against DEC-205 molecules on the surface of dendritic cells. Background technique [0002] Therapeutic antibody drugs have become a hot spot in the biopharmaceutical field. The cell fusion screening monoclonal antibody technology has been widely used since its invention, and has become the most basic and most efficient method for preparing antibodies. However, the methods of cell fusion are mostly limited to animals, such as rats, rabbits, and sheep. By immunizing animals to obtain abundant antigen-specific plasma cells, spleen cell fusion is performed to screen out monoclonal hybridoma cells that secrete antibodies. The antibodies produced by this method are non-human antibodies. If they are used as drugs in the human body, they will produce a strong rejection reaction, so they must be humanized. [0003] Humanized ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28A61K47/68A61P35/00A61P31/12
Inventor 何有文张顶袁晓辉陈彩凤
Owner INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com