Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus C-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit

A detection kit and technology for poultry pneumovirus, applied in the field of fluorescent quantitative RT-PCR kits, fluorescent quantitative RT-PCR detection kits, can solve the hazards of poultry industry, frequent import and export of poultry industry, long distances, etc. question

Active Publication Date: 2013-05-15
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there is no report on APV / C subtype in China, and the geographical distance between the United States and China is far away, the frequent import and export trade between China and the United States poultry industry is likely to cause harm to China's poultry industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus C-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit
  • Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus C-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit
  • Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus C-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Design and synthesis of probe and primer sequence in embodiment 1 kit of the present invention

[0021] According to the G gene sequence of subgroup C of APV in GenBank (GenBank accession number is G C : AY590688.1) Design a pair of upstream and downstream primers for the target gene:

[0022] Upstream primer GCF: 5'GGGCTAGTCAGCTTTGAACTC3' (shown in SEQ ID NO.1)

[0023] Downstream primer GCR: 5'CTGTGTTTGTCTTATTATCCCTTGG3' (shown in SEQ ID NO.2)

[0024] And 1 specific Taqman probe:

[0025] Probe GC: 5'FAM-GCCCTAAGTTTATGTAGGATCCAAGGGACTC-TAMRA3' (shown in SEQ ID NO.3).

[0026] Primers were synthesized by Beijing Liuhe Huada Gene Company, and probes were synthesized by TaKaRa Company.

Embodiment 2

[0027] Example 2 Application of the kit of the present invention in the detection of avian pneumovirus (APV) subgroup C virus

[0028] 1 Materials and methods

[0029] 1.1 Strains and plasmids

[0030] E.coli DH5α is preserved by our laboratory, and the G genes of the four subgroups of APV (GenBank accession numbers are G A : AY640317.1, G B : AB548428.1, G C : AY590688.1, G D : AJ251085.1) was biosynthesized by Harbin Boshi and cloned into pBluescript IIKS (+) vector, respectively named as PBL-G A , PBL-G B , PBL-G C , PBL-G D maintained by the laboratory.

[0031] 1.2 Instruments and reagents

[0032] The LightCycler480 fluorescent quantitative PCR instrument was purchased from Roche Company, and the UV spectrophotometer was purchased from GE Company; plasmid extraction kit AxyGen Company; OneStep RT-PCR kit and Probe RT-PCR kit was purchased from Qiagen, and T7RNA polymerase was purchased from Pragma.

[0033] 1.3 Design and synthesis of probes

[0034] Prepare...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus C-subgroup specificity detection. The kit is characterized by comprising a specificity primer pair and a probe of a specifically amplified avian pneumovirus C-subgroup G-gene, wherein the nucleotide sequences of two primers in the primer pair are respectively shown in SEQ ID NO.1 and SEQ ID NO.2; and the probe sequence is shown in SEQ ID NO.3. By utilizing the kit, the detection on avian pneumovirus C-subgroup viruses can be realized; the kit has good linear relationship within 1*10<3> to 1*10<9> copy.mu L<-1>, the sensitivity is as high as 102 copy.mu L<-1>, that is, the sensitivity is 100 times that of an ordinary RT-PCR method; and moreover the kit has no cross reaction with other poultry disease viruses. The result shows that the kit disclosed by the invention has good sensitivity and specificity, and can be applied to quantitative detection on the avian pneumovirus C-subgroup.

Description

technical field [0001] The invention relates to a fluorescent quantitative RT-PCR detection kit, in particular to a fluorescent quantitative RT-PCR kit for specific detection of subgroup C of avian pneumovirus and its application, belonging to the field of virus detection. Background technique [0002] Avian pneumovirus subtype C (APV / C) was isolated in 1997 from diseased turkey flocks in Colorado, USA. APV belongs to the family Paramyxoviridae, the subfamily Pneumoviridae, and the subgenus Metapneumoviridae. European virus strains are divided into four subtypes, A, B, C, and D, according to their G genes. The C subtype G gene has lower homology with A and B subtypes and is much longer than the A and B G gene sequences. The M protein of APV is highly conserved, the homology of A and B subtype M proteins is 89%, but the homology between C subtype and A and B subtype M proteins is 78% and 77%, respectively, and APV / C subtype The homology of the APV / A and APV / B subtype F pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 高玉龙王笑梅高宏雷王永强祁小乐秦立廷
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI