Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit applied to avian pneumovirus C-subgroup specificity detection, and application of fluorescent quantitative RT-PCR kit
A detection kit and technology for poultry pneumovirus, applied in the field of fluorescent quantitative RT-PCR kits, fluorescent quantitative RT-PCR detection kits, can solve the hazards of poultry industry, frequent import and export of poultry industry, long distances, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Design and synthesis of probe and primer sequence in embodiment 1 kit of the present invention
[0021] According to the G gene sequence of subgroup C of APV in GenBank (GenBank accession number is G C : AY590688.1) Design a pair of upstream and downstream primers for the target gene:
[0022] Upstream primer GCF: 5'GGGCTAGTCAGCTTTGAACTC3' (shown in SEQ ID NO.1)
[0023] Downstream primer GCR: 5'CTGTGTTTGTCTTATTATCCCTTGG3' (shown in SEQ ID NO.2)
[0024] And 1 specific Taqman probe:
[0025] Probe GC: 5'FAM-GCCCTAAGTTTATGTAGGATCCAAGGGACTC-TAMRA3' (shown in SEQ ID NO.3).
[0026] Primers were synthesized by Beijing Liuhe Huada Gene Company, and probes were synthesized by TaKaRa Company.
Embodiment 2
[0027] Example 2 Application of the kit of the present invention in the detection of avian pneumovirus (APV) subgroup C virus
[0028] 1 Materials and methods
[0029] 1.1 Strains and plasmids
[0030] E.coli DH5α is preserved by our laboratory, and the G genes of the four subgroups of APV (GenBank accession numbers are G A : AY640317.1, G B : AB548428.1, G C : AY590688.1, G D : AJ251085.1) was biosynthesized by Harbin Boshi and cloned into pBluescript IIKS (+) vector, respectively named as PBL-G A , PBL-G B , PBL-G C , PBL-G D maintained by the laboratory.
[0031] 1.2 Instruments and reagents
[0032] The LightCycler480 fluorescent quantitative PCR instrument was purchased from Roche Company, and the UV spectrophotometer was purchased from GE Company; plasmid extraction kit AxyGen Company; OneStep RT-PCR kit and Probe RT-PCR kit was purchased from Qiagen, and T7RNA polymerase was purchased from Pragma.
[0033] 1.3 Design and synthesis of probes
[0034] Prepare...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


