Lectin gene of locust tree as well as coded protein and application thereof
A lectin and gene technology, applied in applications, genetic engineering, plant genetic improvement, etc., can solve the problems of inactivation of intestinal functional proteins, affecting the absorption of nutrients, and reducing the permeability of intestinal membranes.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1Lectin gene cloning
[0032] RNA was extracted from Sophora japonica leaves by Trizol method, and reverse-transcribed by reverse transcriptase. Using the reverse-transcribed DNA product as a template for amplifying the target gene, PCR amplification was performed to obtain a cDNA fragment with a length of 867 bp, the base sequence of which was shown in SEQ ID NO: 1, and named: Lectin. Lectin gene, which encodes pagoda lectin, has an amino acid sequence as shown in SEQ ID NO: 2
[0033] The primer sequences are:
[0034] Upstream primer LectinXbaI:
[0035] 5'GCTCTAGAATGGCTTCCTACAAGTT3'
[0036] Downstream primer LectinSmaI:
[0037] 5'GGCCCGGGCGAATTCGAGCTCGGTACCCGTGGATCCTCAAG3'
[0038] Recognition sites for restriction endonucleases XbaI and SmaI were added to the primers to facilitate the ligation of the next amplification product to the carrier.
[0039] The PCR reaction system (50 μL) is: template 2 μL;
[0040] Taq DNA polymerase (10000U / mL) 1 μL...
Embodiment 2
[0047] Embodiment 2Lectin plant expression vector construction
[0048] For the construction process of Lectin plant expression vector p3300-35S-Lectin, see figure 1 .
[0049] Use restriction endonucleases XbaI and SmaI to double-enzyme-cut the PCR amplification product of the vector P3300-35s-tnos and the target gene Lectin respectively, and use T 4 DNA ligase was used to connect the cohesive ends, and the ligated product was used to transform Escherichia coli DH5α for PCR detection to obtain a Lectin plant expression vector, which was named p3300-35S-Lectin.
Embodiment 3
[0050] Example 3 Lectin Plant Expression Vector Agrobacterium-mediated Transformation of Tobacco
[0051] 1. Culture of Agrobacterium
[0052] The plasmid p3300-35S-Lectin containing Lectin was transformed into Agrobacterium Agr0 competent by liquid nitrogen freeze-thaw method, conditions: liquid nitrogen freeze 3min, 37°C 5min. Screen the positive single colonies, and culture them in the liquid LB containing Rif (50mg / L), Sm (100mg / L) and Kan (100mg / L) at 28°C with shaking for 2 days until the logarithmic growth phase.
[0053] 2. Agrobacterium infection and regenerated seedling culture
[0054] Cut the leaves of W38 tobacco sterile seedlings into 0.5cm 2 Small pieces (wounds), with MS 0 Infect the Agrobacterium solution diluted in liquid medium for 15 minutes, blot the infected leaves with sterile paper, remove excess Agrobacterium solution, and put the infected leaves into MS 0 Medium co-cultivation (dark culture) for 2 days.
[0055] Transfer the co-cultured leaf disc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More