Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof

A fragment and gene technology, applied in the field of using RNA interference technology to cultivate transgenic plants with improved insect resistance and its special DNA fragments

Active Publication Date: 2010-10-06
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reported research results show that, in addition to targeting viruses, expressing double-stranded RNA targeting insect genes in plants can also achieve the results of increasing the mortality of related insects that feed on the plant and delaying the growth and development of insects, but the selection of target genes is The most critical issue, screening suitable target genes is an important prerequisite for good results (Ying-Bo Mao, et al, Nat.Biotechnol, 25, 1307-1313 (2007); James A Baum, et al, Nat.Biotechnol , 25, 1322-1326(2007)); In addition, whether this method is effective for insects with piercing-sucking mouthparts, such as aphids, gray planthoppers and other insects, has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof
  • Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1, the cultivation of insect-resistant transgenic plants

[0032] 1. Construction of recombinant expression vector

[0033] 1. Synthesis of the target gene

[0034] Obtain the sequence (NM_001162178) of aphid ATPase E subunit gene mRNA according to http: / / www.ncbi.nlm.nih.gov online information, its specific cDNA sequence is as shown in sequence 1 in the sequence list, synthesizes two according to this sequence Primers were paired and endonuclease sites were introduced (primer 1: 5'TTTGAATTCAGCGACTCAAGATCATGGAG3'; primer 2: 5'TTTGGTACCCTGCCACTTCTTCAACTAAT 3'; primer 3: 5'TTTTCTAGAAGCGACTCAA GATCATGGAG 3'; primer 4: 5'TTTGGATCCCCTGCCACTTCTTCAACTAAT 3').

[0035] Extract the total RNA of the peach aphid (Myzus persicae) of Aphididae (Aphididae), reverse transcribe into cDNA, use the cDNA as a template, carry out PCR amplification with the above-mentioned primer 1 and primer 2, and obtain fragment 1; use the above-mentioned primer 3 and primer 4 were amplified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for cultivating a transgenic plant with improved insect resistance by using RNA interference technology and a special DNA fragment thereof. The DNA fragment is a gene fragment shown as a formula I, wherein a forward sequence (SEQ) is any one fragment which at least comprises 19bp in full-length cDNA fragments of an ATP synthase E subunit gene; a reverse sequence (SEQ) and the forward sequence (SEQ) are mutually reversely complementary; X is a spacer sequence between the forward sequence (SEQ) and the reverse sequence (SEQ), and the X and the forward sequence (SEQ) or the X and the reverse sequence (SEQ) are both not complementary mutually; and the full-length cDNA of the ATP synthase E subunit gene is shown as a sequence 1 in a sequence table. The invention also aims to provide application of the ATP synthase E subunit gene serving as an RNA interference target gene in cultivating the transgenic plant with improved insect resistance. Experiments prove that aphids inoculated to wild-type tobacco grow and reproduce normally; and aphids inoculated to transgenic tobacco starts to die on the fourth day, dead aphid bodies is blackened after five days and no live aphids can be seen after seven days. The formula (I) is forward sequence (SEQ)-X- reverse sequence (SEQ).

Description

technical field [0001] The invention relates to a method for cultivating transgenic plants with improved insect resistance by using RNA interference technology and a special DNA segment thereof. Background technique [0002] Double-stranded RNA exists widely in organisms and plays an important role in the regulation of gene expression. The most important regulatory mechanism is post-transcriptional gene silencing, also known as RNA silencing. At present, this silencing mechanism is mainly used in the research and development of anti-virus transgenic plants, by expressing double-stranded RNA or hairpin structure RNA (shRNA) containing a longer viral genome sequence, and through the Dicer-like gene that specifically cuts double-stranded RNA in plants. Processing by enzymes (DCLs) generates small interfering RNAs (siRNAs) that induce plant resistance to viruses containing homologous sequences. The reported research results show that, in addition to targeting viruses, expressin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82
CPCY02A40/146
Inventor方荣祥陈晓英郭红艳
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI