Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of antisense nucleotide sequences of ribosomal protein analogues RPL22L1 in preparing medicines capable of suppressing growth of ovarian cancer cells

A technology of RPL22L1 and ribosomal protein, which is applied in the direction of drug combination, the use of carriers to introduce foreign genetic material, anti-tumor drugs, etc., can solve the problems of poor chemotherapy effect of ovarian cancer and other problems, so as to improve specificity, inhibit growth and reduce the degree of malignancy Effect

Active Publication Date: 2015-06-24
HARBIN MEDICAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is to provide a method that can inhibit the proliferation, migration and invasion of ovarian cancer cells by interfering with the expression of RPL22L1, and play a role in inhibiting the growth of ovarian cancer cells. medicine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of antisense nucleotide sequences of ribosomal protein analogues RPL22L1 in preparing medicines capable of suppressing growth of ovarian cancer cells
  • Application of antisense nucleotide sequences of ribosomal protein analogues RPL22L1 in preparing medicines capable of suppressing growth of ovarian cancer cells
  • Application of antisense nucleotide sequences of ribosomal protein analogues RPL22L1 in preparing medicines capable of suppressing growth of ovarian cancer cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The construction of embodiment 1 pSuper-shRNA-RPL22L1 gene eukaryotic expression vector

[0057] (1) Synthesize the following oligonucleotide sequences (oligos) containing the antisense nucleotide sequence of the ribosomal protein analogue RPL22L1:

[0058] hRPL22L1-SiR(333)+:GATCCCCAAGAAATACCTTAAGAAGAACTTCAAGAGAGTTTCTTCTTAAGGTATTTCTTTTTTTA (shown in SEQ ID NO.4)

[0059] hRPL22L1-SiR(333)-:AGCTTAAAAAAAGAAATACCTTAAGAAGAACTCTCTTGAAGTTTCTTCTTAAGGTATTTCTTGGG (shown in SEQ ID NO.5)

[0060] or

[0061] hRPL22L1-SiR(687)+:GATCCCCAAAATCTTTTATGTACTCAGGTTCAAGAGACCTGAGTACATAAAAAGATTTTTTTTTA (shown in SEQ ID NO.6)

[0062] hRPL22L1-SiR(687)-:AGCTTAAAAAAAAATCTTTTATGTACTCAGGTCTCTTGAACCTGAGTACATAAAAAGATTTT GGG (shown in SEQ ID NO.7)

[0063] or

[0064] hRPL22L1-SiR(926)+:GATCCCCAAAGTGCTGATTATAGCTGTGTTCAAGAGACACAGCTATAATCAGCACTTTTTTTTA (shown in SEQ ID NO.8)

[0065] hRPL22L1-SiR(926)-:AGCTTAAAAAAAAGTGCTGATTATAGCTGTGTCTCTTGAACACAGCTATAATCAGCACTTT GGG (shown in SEQ ID NO.9)

[...

Embodiment 2

[0088] Example 2 Effect of Inhibiting the Expression of RPL22L1 on the Biological Behavior of UACC-1598 Cells

[0089] 1. Detection of RPL22L1 amplification in tumor cells

[0090] (1) Routine cell culture: the human ovarian cancer cell line UACC-1598 containing double microsomes was selected as the research object, and RPMI-1640 medium containing 10% fetal bovine serum was used in CO 2 Cultured in an incubator at 37°C.

[0091] (2) Detection of RPL22L1 amplification in UACC-1598 cells by DNA and mRNA levels:

[0092] For DNA level, normal human peripheral blood DNA and human embryonic kidney cell HEK293DNA were used as controls to detect the amplification of RPL22L1 in UACC-1598; for mRNA level, normal human ovarian tissue cDNA and human embryonic kidney cell HEK293cDNA were used as controls to detect RPL22L1 amplification Amplification in UACC-1598. The controls used in the above two levels are the samples that have been extracted in our laboratory earlier.

[0093] The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of antisense nucleotide sequences of ribosomal protein analogues RPL22L1 in preparing medicines capable of suppressing growth of ovarian cancer cells. The application is characterized in that the antisense nucleotide sequences of three pairs of ribosomal protein analogues RPL22L1 are synthesized and are respectively shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3. According to the invention, aiming to the high-amplification ovarian cancer cells of RPL22L1, the antisense nucleotide sequences of the RPL22L1 are utilized, and the expression of the RPL22L1 is reduced through adopting an RNAi interference method. According to the study, the nucleotide sequences can effectively suppress the growth of the ovarian cancer cells to reduce the malignity degree. When the antisense nucleotide sequences of the RPL22L1 are applied to the preparation of the medicines capable of suppressing growth of ovarian cancer cells, novel medicine selection and targeted therapies can be provided for biological treatment of the ovarian cancer, thereby improving the therapeutic specificity.

Description

technical field [0001] The present invention relates to a new application of the antisense nucleotide sequence of the ribosomal protein analogue RPL22L1, specifically, the present invention relates to the use of the antisense nucleotide sequence of the ribosomal protein analogue RPL22L1 in the preparation of drugs for inhibiting the growth of ovarian cancer cells The application of the invention belongs to the technical field of tumor biotherapy. Background technique [0002] RPL22L1 (ribosomal protein L22-like1) has a highly homologous structure with ribosomal protein RPL22. Ribosome is an important organelle for protein synthesis in cells, mainly composed of 4 ribosomal RNAs and more than 80 ribosomal proteins. During the translation process of ribosomes, ribosomal proteins can promote rRNA folding, "fine-tune" ribosome spatial conformation, coordinate the interaction between ribosomes and mRNA at the ribosome binding site, and cooperate with rRNA to catalyze protein synth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00C12N15/113C12N15/63C12N15/66A61P35/00A61P15/08
Inventor 傅松滨金焰秦颖吴楠孟祥宁孙文靖
Owner HARBIN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com